WormBase Tree Display for Variation: WBVar00000118
expand all nodes | collapse all nodes | view schema
| WBVar00000118 | Evidence | Paper_evidence | WBPaper00006349 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ak66 | |||||
| Other_name | C15A11.3.1:c.967G>C | ||||||
| CE36685:p.Gly323Arg | |||||||
| HGVSg | CHROMOSOME_I:g.7390533C>G | ||||||
| Sequence_details | SMap | S_parent | Sequence | C15A11 | |||
| Flanking_sequences | cttccaacgaaatgtcaaattgtactacag | gatacccaaatgagaagattagtgtaaaat | |||||
| Mapping_target | C15A11 | ||||||
| Type_of_mutation | Substitution | g | m | Paper_evidence | WBPaper00006349 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | VM | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004944 | |||||
| Transcript | C15A11.3.1 (12) | ||||||
| Genetics | Interpolated_map_position | I | 2.06336 | ||||
| Reference | WBPaper00006349 | ||||||
| Remark | ak66 is either a GGA->CGA or GGA->AGA mutation | Curator_confirmed | WBPerson1845 | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00004944 Missense 323 G to R | Paper_evidence | WBPaper00006349 | |||||
| Method | Substitution_allele |
