WormBase Tree Display for Variation: WBVar00000042
expand all nodes | collapse all nodes | view schema
WBVar00000042 | Evidence | Paper_evidence | WBPaper00031996 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ad601 | |||||||
Other_name | B0365.3.1:c.1565G>A | ||||||||
B0365.3.2:c.1565G>A | |||||||||
CE07721:p.Gly522Glu | |||||||||
HGVSg | CHROMOSOME_V:g.13128181C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0365 | |||||
Flanking_sequences | acactgcctatcttgagttgggaggaatgg | agaacgtgttctcggattctgtgacttcgt | |||||||
Mapping_target | B0365 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031996 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005489 | ||||||||
Laboratory | DA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001137 | |||||||
Transcript | B0365.3.2 (12) | ||||||||
B0365.3.1 (12) | |||||||||
Interactor | WBInteraction000503690 | ||||||||
WBInteraction000503691 | |||||||||
WBInteraction000541752 | |||||||||
WBInteraction000541753 | |||||||||
Genetics | Interpolated_map_position | V | 4.9376 | ||||||
Description | Phenotype (12) | ||||||||
Phenotype_not_observed | WBPhenotype:0000655 | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals responded like wild type to GABA agonist muscimol (data not shown) | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003906 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were treated with muscimol. | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001321 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No gross differences were observed in the pan-neuronal or GABAergic pattern or expression levels of synaptic vesicle protein SNB-1::GFP compared to wild type. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005829 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs1 (Psnb-1::SNB-1::GFP) or juIs1 (Punc-25::SNB-1::GFP) | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00015075 | ||||||||
WBPaper00031996 | |||||||||
WBPaper00001709 | |||||||||
WBPaper00003257 | |||||||||
Method | Substitution_allele |