WormBase Tree Display for Variation: WBVar00000002
expand all nodes | collapse all nodes | view schema
| WBVar00000002 | Evidence | Paper_evidence | WBPaper00035215 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ac1 | ||||||
| Other_name | CE53914:p.Gly151Glu | |||||||
| Y51H7C.11.1:c.452G>A | ||||||||
| HGVSg | CHROMOSOME_II:g.1436946C>T | |||||||
| Sequence_details | SMap | S_parent | Sequence | Y51H7C | ||||
| Flanking_sequences | aattcgaaaaagtcgagttcacagccggtg | agcccacagagatgacccaattttcgcgga | ||||||
| Mapping_target | Y51H7C | |||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00035215 | |||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00000321 | |||||||
| Laboratory | AY | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00021789 | ||||||
| Transcript | Y51H7C.11.1 (12) | |||||||
| Interactor | WBInteraction000525378 | |||||||
| WBInteraction000525379 | ||||||||
| Genetics | Interpolated_map_position | II | -15.4472 | |||||
| Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00047105 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | In this mutant, there was increased expression of inflammatory molecules such as sym-1. Authors utilized nol-6 mutant worms as a potential model of chronic inflammation that could mimic the phenotypic features of senescent human endothelial cells and Apoe KO mice, because this mutant displays over-activation of innate immunity. | Paper_evidence | WBPaper00047105 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00047105 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_assay | Treatment | Temperature-sensitive nol-6 mutants were maintained at 15C. | Paper_evidence | WBPaper00047105 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0001171 | Paper_evidence | WBPaper00047105 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | The lifespan of nol-6 mutants raised at 22C was significantly shorter than that of wild-type worms. | Paper_evidence | WBPaper00047105 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00047105 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_assay | Treatment | nol-6 mutants were maintained at 15C. Lifespan experiments were performed at 22C. | Paper_evidence | WBPaper00047105 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| Temperature | 22 | Paper_evidence | WBPaper00047105 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Reference | WBPaper00035215 | |||||||
| WBPaper00047105 | ||||||||
| Method | Substitution_allele |
