WormBase Tree Display for Variation: WBVar00248890
expand all nodes | collapse all nodes | view schema
WBVar00248890 | Evidence | Person_evidence | WBPerson625 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sy16 | ||||||
Other_name | CE42891:p.Thr1004Ile | |||||||
ZK1067.1d.1:c.3230C>T | ||||||||
ZK1067.1c.1:c.3209C>T | ||||||||
ZK1067.1b.1:c.3011C>T | ||||||||
CE03840:p.Thr1065Ile | ||||||||
CE50411:p.Thr1077Ile | ||||||||
CE42910:p.Thr1070Ile | ||||||||
ZK1067.1a.1:c.3194C>T | ||||||||
HGVSg | CHROMOSOME_II:g.9205736C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | ||||
Flanking_sequences | cgatcgaaatcttctccaaacattgttaca | ccatgcttctgatgtttgggcatttggagt | ||||||
Mapping_target | ZK1067 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001917 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | PS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002299 | ||||||
Transcript | ZK1067.1d.1 (12) | |||||||
ZK1067.1b.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
SIFT | 0.01 | deleterious | ||||||
PolyPhen | 0.997 | probably_damaging | ||||||
HGVSc | ZK1067.1b.1:c.3011C>T | |||||||
HGVSp | CE42891:p.Thr1004Ile | |||||||
cDNA_position | 3011 | |||||||
CDS_position | 3011 | |||||||
Protein_position | 1004 | |||||||
Exon_number | 13/16 | |||||||
Codon_change | aCc/aTc | |||||||
Amino_acid_change | T/I | |||||||
ZK1067.1c.1 (12) | ||||||||
ZK1067.1a.1 (12) | ||||||||
Isolation | Mutagen | EMS | ||||||
Forward_genetics | F1 non-complementation screen against let-23(sy1) | Curator_confirmed | WBPerson1250 | |||||
Genetics | Interpolated_map_position | II | 1.09463 | |||||
Description | Phenotype | WBPhenotype:0000054 | Paper_evidence | WBPaper00002375 | ||||
Person_evidence | WBPerson625 | |||||||
Curator_confirmed | WBPerson1250 | |||||||
WBPerson712 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson625 | |||||
Curator_confirmed | WBPerson1250 | |||||||
Recessive (2) | ||||||||
Variation_effect | Null | Person_evidence | WBPerson625 | |||||
Curator_confirmed | WBPerson1250 | |||||||
Phenotype_assay | Genotype | him-5(e1490) | Person_evidence | WBPerson625 | ||||
Curator_confirmed | WBPerson1250 | |||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Identified in a noncomplementation screen with let-23(sy1) scoring for the Vulvaless phenotype. | Paper_evidence | WBPaper00001404 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive (2) | ||||||||
Reference | WBPaper00001404 | |||||||
WBPaper00002375 | ||||||||
Method | Substitution_allele |