WormBase Tree Display for Variation: WBVar00143085
expand all nodes | collapse all nodes | view schema
WBVar00143085 | Evidence | Paper_evidence | WBPaper00004985 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e283 | |||||
Other_name | ZC416.8b.1:c.-1+1338C>T | ||||||
CE17307:p.Arg60Trp | |||||||
ZC416.8a.1:c.178C>T | |||||||
HGVSg | CHROMOSOME_IV:g.3623294G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | ZC416 | |||
Flanking_sequences | gtcattgtcccaattattccgaaatacctt | gggacattcataactaccaggtgaccttcg | |||||
Mapping_target | ZC416 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004985 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene (2) | ||||||
Transcript | ZC416.8a.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
SIFT | 0 | deleterious | |||||
PolyPhen | 1 | probably_damaging | |||||
HGVSc | ZC416.8a.1:c.178C>T | ||||||
HGVSp | CE17307:p.Arg60Trp | ||||||
cDNA_position | 260 | ||||||
CDS_position | 178 | ||||||
Protein_position | 60 | ||||||
Exon_number | 3/6 | ||||||
Codon_change | Cgg/Tgg | ||||||
Amino_acid_change | R/W | ||||||
ZC416.8b.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | ZC416.8b.1:c.-1+1338C>T | ||||||
Intron_number | 1/11 | ||||||
Genetics | Interpolated_map_position | IV | -3.08464 | ||||
Reference | WBPaper00004985 | ||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 178 R to W | Paper_evidence | WBPaper00004985 | ||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000481 Intron Inferred_automatically map_Alleles.pl | |||||||
Method | Substitution_allele |