WormBase Tree Display for Variation: WBVar00143652
expand all nodes | collapse all nodes | view schema
WBVar00143652 | Evidence | Person_evidence | WBPerson10095 | |||
---|---|---|---|---|---|---|
Name | Public_name | e977 | ||||
Other_name (2) | ||||||
HGVSg | CHROMOSOME_IV:g.6377426G>A | |||||
Sequence_details | SMap | S_parent | Sequence | Y73B6BL | ||
Flanking_sequences | tcaacgaggtctcctcgatccgttccaacc | taccgcccgtcaagcttcttacggagattc | ||||
Mapping_target | Y73B6BL | |||||
Type_of_mutation | Substitution | g | a | |||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain | WBStrain00051523 | |||||
Laboratory | CB | |||||
Status | Live | |||||
Affects | Gene | WBGene00000256 | ||||
Transcript | Y73B6BL.34.1 | VEP_consequence | missense_variant | |||
VEP_impact | MODERATE | |||||
SIFT | 0.01 | deleterious | ||||
PolyPhen | 0.944 | possibly_damaging | ||||
HGVSc | Y73B6BL.34.1:c.212G>A | |||||
HGVSp | CE29928:p.Arg71His | |||||
cDNA_position | 254 | |||||
CDS_position | 212 | |||||
Protein_position | 71 | |||||
Exon_number | 3/4 | |||||
Codon_change | cGt/cAt | |||||
Amino_acid_change | R/H | |||||
Genetics | Gene_class | bli | ||||
Interpolated_map_position | IV | 3.18862 | ||||
Remark | Variation information submitted by WBPerson10095 on 2022-02-17_15:55:28 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
alt_det = g to a mut_det = R71H | Person_evidence | WBPerson10095 | ||||
Curator_confirmed | WBPerson51134 | |||||
Method | Substitution_allele |