WormBase Tree Display for Variation: WBVar00089657
expand all nodes | collapse all nodes | view schema
WBVar00089657 | Evidence | Paper_evidence | WBPaper00002543 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n669 | |||||||
Other_name | CE28810:p.Gly486Arg | ||||||||
Y71F9B.5b.1:c.1456G>A | |||||||||
Y71F9B.5a.1:c.1456G>A | |||||||||
CE50007:p.Gly418Arg | |||||||||
Y71F9B.5c.1:c.1252G>A | |||||||||
Y71F9B.5a.2:c.1456G>A | |||||||||
CE25569:p.Gly486Arg | |||||||||
HGVSg | CHROMOSOME_I:g.2714959G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y71F9B | |||||
Flanking_sequences | atgaccgccgtaatttccagtctcgccaca | gattctcgtgtctgatgtgggtgttgtcgg | |||||||
Mapping_target | Y71F9B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002543 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003006 | |||||||
Transcript (4) | |||||||||
Genetics | Interpolated_map_position | I | -7.32057 | ||||||
Description | Phenotype | WBPhenotype:0000257 | Paper_evidence | WBPaper00002543 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult hermaphrodites exhibited phasmid defects as assayed by DiO dye-filling. | Paper_evidence | WBPaper00002543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Single protrusion posterior to the vulva. | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00000762 | ||||||||
WBPaper00002543 | |||||||||
WBPaper00010926 | |||||||||
Method | Substitution_allele |