WormBase Tree Display for Variation: WBVar02157257
expand all nodes | collapse all nodes | view schema
WBVar02157257 | Evidence | Person_evidence | WBPerson282 | |||
---|---|---|---|---|---|---|
Name | Public_name | iw81 | ||||
Other_name | Y55D5A.5d.1:c.1153C>T | |||||
Y55D5A.5a.1:c.1294C>T | ||||||
CE50158:p.Leu356Phe | ||||||
Y55D5A.5e.1:c.1066C>T | ||||||
CE46852:p.Leu432Phe | ||||||
Y55D5A.5c.1:c.1294C>T | ||||||
CE50204:p.Leu432Phe | ||||||
CE50312:p.Leu385Phe | ||||||
HGVSg | CHROMOSOME_III:g.3013267G>A | |||||
Sequence_details | SMap | S_parent | Sequence | Y55D5A | ||
Flanking_sequences | cacgggtcacacaacgacgttgaaggagaa | gtacaggtgagcatcacacttttcgataca | ||||
Mapping_target | Y55D5A | |||||
Type_of_mutation | Substitution | g | a | |||
SeqStatus | Sequenced | |||||
Origin | Species | Caenorhabditis elegans | ||||
Status | Live | |||||
Affects | Gene | WBGene00000898 | ||||
Transcript | Y55D5A.5e.1 (12) | |||||
Y55D5A.5a.1 (12) | ||||||
Y55D5A.5c.1 (12) | ||||||
Y55D5A.5d.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | |||||
SIFT | 0.19 | tolerated | ||||
PolyPhen | 0.954 | possibly_damaging | ||||
HGVSc | Y55D5A.5d.1:c.1153C>T | |||||
HGVSp | CE50312:p.Leu385Phe | |||||
cDNA_position | 1153 | |||||
CDS_position | 1153 | |||||
Protein_position | 385 | |||||
Exon_number | 8/16 | |||||
Codon_change | Ctt/Ttt | |||||
Amino_acid_change | L/F | |||||
Possibly_affects | WBGene00000898 | Paper_evidence | WBPaper00060588 | |||
Remark | CGC_name daf-2 | |||||
Isolation | Mutagen | EMS | ||||
Genetics | Interpolated_map_position | III | -8.05789 | |||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00060588 | ||
Curator_confirmed | WBPerson282 | |||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00060588 | ||||
Curator_confirmed | WBPerson282 | |||||
Reference | WBPaper00060588 | |||||
Remark | [2022-03-22T01:14:38.863Z WBPerson2987] New Variation: WBPaper00060588; allele of daf-2; Using Y55D5A.5a transcript predicted to generate a protein of 1,846 amino acids as the reference, the molecular changes are iw81 L432F (CTT to TTT)... | Curator_confirmed | WBPerson2987 | |||
alt_det = C to T mut_det = L432F Y55D5A.5a | Person_evidence | WBPerson282 | ||||
Curator_confirmed | WBPerson51134 | |||||
Variation information submitted by WBPerson282 on 2022-03-18_15:21:59 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | ||||
Method | Substitution_allele |