WormBase Tree Display for Variation: WBVar00143653
expand all nodes | collapse all nodes | view schema
WBVar00143653 | Name | Public_name | e979 | |||
---|---|---|---|---|---|---|
Other_name | CE46852:p.Cys146Tyr | |||||
Y55D5A.5c.1:c.437G>A | ||||||
Y55D5A.5a.1:c.437G>A | ||||||
CE50204:p.Cys146Tyr | ||||||
Y55D5A.5d.1:c.296G>A | ||||||
CE50312:p.Cys99Tyr | ||||||
CE50158:p.Cys70Tyr | ||||||
Y55D5A.5e.1:c.209G>A | ||||||
HGVSg | CHROMOSOME_III:g.3017014C>T | |||||
Sequence_details | SMap | S_parent | Sequence | Y55D5A | ||
Flanking_sequences | agccgtgtgcctcaatagtcgaaaaacgat | cggcccaatcgatattcgaaataggccgtg | ||||
Mapping_target | Y55D5A | |||||
Type_of_mutation | Substitution | g | a | |||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain | WBStrain00006391 | |||||
Laboratory | CB | |||||
Status | Live | |||||
Affects | Gene | WBGene00000898 | ||||
Transcript | Y55D5A.5e.1 (12) | |||||
Y55D5A.5a.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | |||||
SIFT | 0 | deleterious | ||||
PolyPhen | 0.999 | probably_damaging | ||||
HGVSc | Y55D5A.5a.1:c.437G>A | |||||
HGVSp | CE46852:p.Cys146Tyr | |||||
cDNA_position | 535 | |||||
CDS_position | 437 | |||||
Protein_position | 146 | |||||
Exon_number | 6/19 | |||||
Codon_change | tGc/tAc | |||||
Amino_acid_change | C/Y | |||||
Y55D5A.5c.1 (12) | ||||||
Y55D5A.5d.1 (12) | ||||||
Interactor | WBInteraction000009107 | |||||
WBInteraction000009108 | ||||||
WBInteraction000052470 | ||||||
WBInteraction000517272 | ||||||
WBInteraction000517275 | ||||||
WBInteraction000517276 | ||||||
WBInteraction000517281 | ||||||
Genetics | Interpolated_map_position | III | -8.03771 | |||
Description (2) | ||||||
Reference | WBPaper00031936 | |||||
WBPaper00000214 | ||||||
WBPaper00037649 | ||||||
WBPaper00031688 | ||||||
WBPaper00035504 | ||||||
WBPaper00059059 | ||||||
Remark | Allele e979 is cited in WBPaper00005310. A subsequent erratum explains that the strain was incorrectly referred to as daf-2(e979) but was infact daf-2(m41). | Curator_confirmed | WBPerson2970 | |||
Method | Substitution_allele |