WormBase Tree Display for Variation: WBVar00144467
expand all nodes | collapse all nodes | view schema
WBVar00144467 | Evidence | Paper_evidence | WBPaper00002121 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1998 | |||||||
Other_name | CE52672:p.Pro88Leu | ||||||||
CE52664:p.Pro88Leu | |||||||||
Y47D3A.6b.1:c.263C>T | |||||||||
Y47D3A.6a.1:c.263C>T | |||||||||
HGVSg | CHROMOSOME_III:g.11191847G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y47D3A | |||||
Flanking_sequences | ttcccccgtcacatcaaactttgagcaatc | tctgcagctgagcccaccggcagaagcttc | |||||||
Mapping_target | Y47D3A | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002121 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene (2) | ||||||||
Transcript | Y48A6C.12 | ||||||||
Y47D3A.6b.1 (12) | |||||||||
Y47D3A.6a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious_low_confidence | |||||||
PolyPhen | 0.997 | probably_damaging | |||||||
HGVSc | Y47D3A.6a.1:c.263C>T | ||||||||
HGVSp | CE52672:p.Pro88Leu | ||||||||
cDNA_position | 401 | ||||||||
CDS_position | 263 | ||||||||
Protein_position | 88 | ||||||||
Exon_number | 5/20 | ||||||||
Codon_change | cCt/cTt | ||||||||
Amino_acid_change | P/L | ||||||||
Genetics | Interpolated_map_position | III | 6.94309 | ||||||
Description | Phenotype | WBPhenotype:0000687 | Paper_evidence | WBPaper00000922 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | tra-1/+ XX animals are usually fertile females and tra-l/+ XO animals are females or intersexes. Homozygous XX and XO animals are completely feminized. | Paper_evidence | WBPaper00000922 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00000922 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000922 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00000922 | ||||||||
Method | Substitution_allele |