WormBase Tree Display for Variation: WBVar02120591
expand all nodes | collapse all nodes | view schema
WBVar02120591 | Name | Public_name | WBVar02120591 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851514 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_II | ||||
Flanking_sequences | CAAGCATGGCCAAGGCCGTACAGGTGAGCA | ACCTGGCGACCCCAAAGAGTCCAATGTGCA | ||||||
Mapping_target | CHROMOSOME_II | |||||||
Source_location | 225 | CHROMOSOME_II | 878001 | 916000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000034 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00004599 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (12) | |||||||
Transcript | T07D3.4b.1 | |||||||
T07D3.9b.1 | ||||||||
T07D3.9a.2 | ||||||||
T07D3.4a.1 | ||||||||
R07C3.9.1 | ||||||||
T07D3.9a.1 | ||||||||
T07D3.7b.1 | ||||||||
R07C3.11b.1 | ||||||||
R07C3.11a.1 | ||||||||
T07D3.7a.1 | ||||||||
R07C3.8.1 | ||||||||
R07C3.10.1 | ||||||||
T07D3.2.1 | ||||||||
Pseudogene | T07D3.3 | |||||||
T07D3.1 | ||||||||
T07D3.6 | ||||||||
T07D3.5 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |