WormBase Tree Display for Variation: WBVar00274941
expand all nodes | collapse all nodes | view schema
WBVar00274941 | Evidence | Person_evidence | WBPerson201 | ||
---|---|---|---|---|---|
Name | Public_name | ut111 | |||
Sequence_details | SMap | S_parent | Sequence | ZC101 | |
Flanking_sequences | ATCCAGTTCAACTTTCGGATGCTGGTACAT | ACATCTGTGTGTCGGACTACAATGGAAACA | |||
Mapping_target | ZC101 | ||||
Type_of_mutation | Insertion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Transposon_insertion | Tc1 | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00022187 | ||||
Laboratory | JC | ||||
Status | Live | ||||
Affects | Gene | WBGene00006787 | |||
Transcript | ZC101.2l.1 | ||||
ZC101.2c.1 | |||||
ZC101.2f.1 | |||||
ZC101.2j.1 | |||||
ZC101.2o.1 | |||||
ZC101.2n.1 | |||||
ZC101.2b.1 | |||||
ZC101.2k.1 | |||||
ZC101.2d.1 | |||||
ZC101.2e.1 | |||||
ZC101.2m.1 | |||||
ZC101.2a.1 | |||||
ZC101.2i.1 | |||||
ZC101.2r.1 | |||||
Genetics | Interpolated_map_position | II | 23.3347 | ||
Description | Phenotype (3) | ||||
Phenotype_not_observed | WBPhenotype:0000644 | Person_evidence | WBPerson201 | ||
WBPerson261 | |||||
Curator_confirmed | WBPerson48 | ||||
WBPerson712 | |||||
Reference | WBPaper00014555 | ||||
WBPaper00002086 | |||||
Remark | Complements class 1 alleles of unc-52. Not a complete null since low levels of unc-52 protein are detected in the mutant. This may result from the Tcl element being removed from some of the gene transcripts by splicing. | Person_evidence | WBPerson201 | ||
Method | Transposon_insertion |