WormBase Tree Display for Variation: WBVar00145031
expand all nodes | collapse all nodes | view schema
WBVar00145031 | Evidence | Paper_evidence | WBPaper00031667 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e2882 | ||||||
Other_name (4) | ||||||||
HGVSg | CHROMOSOME_X:g.5494226C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T23F2 | ||||
Flanking_sequences | actgccattttccacaacagttagtaacac | gtctcgatttttcctgtatagatggtatgc | ||||||
Mapping_target | T23F2 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031667 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004682 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00044623 | ||||||
Transcript | T23F2.1b.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | T23F2.1b.1:c.404C>T | |||||||
HGVSp | CE54583:p.Pro135Leu | |||||||
cDNA_position | 404 | |||||||
CDS_position | 404 | |||||||
Protein_position | 135 | |||||||
Exon_number | 4/9 | |||||||
Codon_change | cCg/cTg | |||||||
Amino_acid_change | P/L | |||||||
T23F2.1a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
SIFT | 0.05 | tolerated | ||||||
PolyPhen | 1 | probably_damaging | ||||||
HGVSc | T23F2.1a.1:c.362C>T | |||||||
HGVSp | CE28488:p.Pro121Leu | |||||||
cDNA_position | 362 | |||||||
CDS_position | 362 | |||||||
Protein_position | 121 | |||||||
Exon_number | 3/9 | |||||||
Codon_change | cCg/cTg | |||||||
Amino_acid_change | P/L | |||||||
Genetics | Interpolated_map_position | X | -5.24244 | |||||
Description | Phenotype | WBPhenotype:0000010 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals show enhanced sensitivity to drugs of a variety of sizes and structures. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Gravid hermaphrodites were placed into wells (of 96-well plates) containing the compound. Sensitivity was assessed based on the time until paralysis ensued. Concentrations of the compounds are as follows: Nicotine, 0.1%v/v in M9; 1-Phenoxypropan-2-ol , 0.1% or 0.5% in M9; Ivermectin dissolved in DMSO and diluted to 2.5ug/ml in M9. | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals show significant larval lethality particularly during molting. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 22.5 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000638 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Molting defects are observed, such as body restriction points, due to incomplete cuticle shedding. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 22.5 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001209 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are Unc. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001413 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031667 | |||||||
Method | Substitution_allele |