WormBase Tree Display for Variation: WBVar00142908
expand all nodes | collapse all nodes | view schema
WBVar00142908 | Evidence | Paper_evidence | WBPaper00006395 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e12 | ||||||
Other_name | CE35021:p.Gly149Glu | |||||||
T21D12.2b.1:c.446G>A | ||||||||
T21D12.2a.1:c.446G>A | ||||||||
CE49091:p.Gly149Glu | ||||||||
HGVSg | CHROMOSOME_IV:g.258714C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T21D12 | ||||
Flanking_sequences | aatgtccaactggagctccaggaccaccag | acttccaggtaaatttgaattgcatcagga | ||||||
Mapping_target | T21D12 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (9) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001071 | ||||||
Transcript | T21D12.2b.1 (12) | |||||||
T21D12.2a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
SIFT | 0 | deleterious | ||||||
PolyPhen | 0.983 | probably_damaging | ||||||
HGVSc | T21D12.2a.1:c.446G>A | |||||||
HGVSp | CE35021:p.Gly149Glu | |||||||
cDNA_position | 447 | |||||||
CDS_position | 446 | |||||||
Protein_position | 149 | |||||||
Exon_number | 3/6 | |||||||
Codon_change | gGa/gAa | |||||||
Amino_acid_change | G/E | |||||||
Interactor | WBInteraction000503698 | |||||||
WBInteraction000537309 | ||||||||
Genetics | Interpolated_map_position | IV | -26.772 | |||||
Mapping_data | In_2_point (16) | |||||||
In_multi_point (25) | ||||||||
In_pos_neg_data | 2140 | |||||||
3687 | ||||||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Life span of animals were not greater than that of wild type worms in the absence of infection. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Disease_info | Models_disease | DOID:37 | ||||||
Models_disease_in_annotation | WBDOannot00001177 | |||||||
Reference (14) | ||||||||
Method | Substitution_allele |