WormBase Tree Display for Variation: WBVar00144076
expand all nodes | collapse all nodes | view schema
WBVar00144076 | Evidence | Paper_evidence | WBPaper00000502 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1526 | |||||
Other_name (13) | |||||||
HGVSg | CHROMOSOME_V:g.6965589C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | T07H8 | |||
Flanking_sequences | ggaacagatccgtgtatggaatctttggat | gtggaagttggtgtgaggcaatgtcaaata | |||||
Mapping_target | T07H8 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024622 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects (2) | |||||||
Genetics | Interpolated_map_position | V | 0.483134 | ||||
Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | |||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001310 | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Cell bodies of anterior touch neurons displaced dorsally. | Paper_evidence | WBPaper00000502 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001398 | Paper_evidence | WBPaper00038449 | |||||
Curator_confirmed | WBPerson3779 | ||||||
WBPhenotype:0001534 | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | ECM is missing along the VC. | Paper_evidence | WBPaper00000502 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001676 | Paper_evidence | WBPaper00038449 | |||||
Curator_confirmed | WBPerson3779 | ||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00038449 | ||||
Curator_confirmed | WBPerson3779 | ||||||
Reference | WBPaper00038449 | ||||||
WBPaper00000502 | |||||||
Method | Substitution_allele |