WormBase Tree Display for Variation: WBVar02150061
expand all nodes | collapse all nodes | view schema
WBVar02150061 | Evidence | Paper_evidence | WBPaper00058674 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sy887 | |||||
Other_name | T07A9.6.1:c.343C>G | ||||||
CE26385:p.Leu115Val | |||||||
HGVSg | CHROMOSOME_IV:g.424756G>C | ||||||
Sequence_details | SMap | S_parent | Sequence | T07A9 | |||
Flanking_sequences | tatccgcatcgtagtagtatccaccgcgca | gttaaacaccttcacgttgccctttccgtg | |||||
Mapping_target | T07A9 | ||||||
Type_of_mutation | Substitution | g | c | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00047063 | Curator_confirmed | WBPerson1983 | ||||
Laboratory | PS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000913 | |||||
Transcript | T07A9.6.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
SIFT | 0 | deleterious_low_confidence | |||||
PolyPhen | 1 | probably_damaging | |||||
HGVSc | T07A9.6.1:c.343C>G | ||||||
HGVSp | CE26385:p.Leu115Val | ||||||
cDNA_position | 372 | ||||||
CDS_position | 343 | ||||||
Protein_position | 115 | ||||||
Exon_number | 3/9 | ||||||
Codon_change | Ctg/Gtg | ||||||
Amino_acid_change | L/V | ||||||
Genetics | Interpolated_map_position | IV | -26.0089 | ||||
Description | Phenotype_not_observed | WBPhenotype:0000013 | Paper_evidence | WBPaper00058674 | |||
Curator_confirmed | WBPerson712 | ||||||
Image | WBPicture0000014933 | Paper_evidence | WBPaper00058674 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00058674 | ||||||
Remark | Created in the nameserver by Karen Yook | ||||||
WBPaper00058674 daf-18 L115V | |||||||
Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000913 Missense 115 L to V | Paper_evidence | WBPaper00058674 | |||||
Method | Substitution_allele |