WormBase Tree Display for Variation: WBVar02150061
expand all nodes | collapse all nodes | view schema
| WBVar02150061 | Evidence | Paper_evidence | WBPaper00058674 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | sy887 | |||||
| Other_name | T07A9.6.1:c.343C>G | ||||||
| CE26385:p.Leu115Val | |||||||
| HGVSg | CHROMOSOME_IV:g.424756G>C | ||||||
| Sequence_details | SMap | S_parent | Sequence | T07A9 | |||
| Flanking_sequences | tatccgcatcgtagtagtatccaccgcgca | gttaaacaccttcacgttgccctttccgtg | |||||
| Mapping_target | T07A9 | ||||||
| Type_of_mutation | Substitution | g | c | Curator_confirmed | WBPerson4055 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00047063 | Curator_confirmed | WBPerson1983 | ||||
| Laboratory | PS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000913 | |||||
| Transcript | T07A9.6.1 | VEP_consequence | missense_variant | ||||
| VEP_impact | MODERATE | ||||||
| SIFT | 0 | deleterious_low_confidence | |||||
| PolyPhen | 1 | probably_damaging | |||||
| HGVSc | T07A9.6.1:c.343C>G | ||||||
| HGVSp | CE26385:p.Leu115Val | ||||||
| cDNA_position | 372 | ||||||
| CDS_position | 343 | ||||||
| Protein_position | 115 | ||||||
| Exon_number | 3/9 | ||||||
| Codon_change | Ctg/Gtg | ||||||
| Amino_acid_change | L/V | ||||||
| Genetics | Interpolated_map_position | IV | -26.0089 | ||||
| Description | Phenotype_not_observed | WBPhenotype:0000013 | Paper_evidence | WBPaper00058674 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Image | WBPicture0000014933 | Paper_evidence | WBPaper00058674 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00058674 | ||||||
| Remark | Created in the nameserver by Karen Yook | ||||||
| WBPaper00058674 daf-18 L115V | |||||||
| Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000913 Missense 115 L to V | Paper_evidence | WBPaper00058674 | |||||
| Method | Substitution_allele |
