WormBase Tree Display for Variation: WBVar02150060
expand all nodes | collapse all nodes | view schema
WBVar02150060 | Evidence | Paper_evidence | WBPaper00058674 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sy879 | |||||
Other_name | CE26385:p.Asp66Glu | ||||||
T07A9.6.1:c.198C>G | |||||||
HGVSg | CHROMOSOME_IV:g.424951G>C | ||||||
Sequence_details | SMap | S_parent | Sequence | T07A9 | |||
Flanking_sequences | tcgttgtcgcaccgagtaccaaaatatcga | ctagattgtgcatgtaaggcacttctcttg | |||||
Mapping_target | T07A9 | ||||||
Type_of_mutation | Substitution | c | r | Curator_confirmed | WBPerson1983 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00047062 | Curator_confirmed | WBPerson1983 | ||||
Laboratory | PS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000913 | |||||
Transcript | T07A9.6.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
SIFT | 0.01 | deleterious_low_confidence | |||||
PolyPhen | 0.998 | probably_damaging | |||||
HGVSc | T07A9.6.1:c.198C>G | ||||||
HGVSp | CE26385:p.Asp66Glu | ||||||
cDNA_position | 227 | ||||||
CDS_position | 198 | ||||||
Protein_position | 66 | ||||||
Exon_number | 2/9 | ||||||
Codon_change | gaC/gaG | ||||||
Amino_acid_change | D/E | ||||||
Genetics | Interpolated_map_position | IV | -26.0086 | ||||
Description | Phenotype_not_observed | WBPhenotype:0000013 | Paper_evidence | WBPaper00058674 | |||
Curator_confirmed | WBPerson712 | ||||||
Image | WBPicture0000014933 | Paper_evidence | WBPaper00058674 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00058674 | ||||||
Remark | Created in the nameserver by Karen Yook | ||||||
WBPaper00058674 daf-18 D66E | |||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000913 Missense 66 D to E | Paper_evidence | WBPaper00058674 | |||||
Method | Substitution_allele |