WormBase Tree Display for Variation: WBVar00241100
expand all nodes | collapse all nodes | view schema
WBVar00241100 | Evidence | Paper_evidence | WBPaper00004647 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | q388 | ||||||
Other_name | T01H8.5d.2:c.2560G>A | |||||||
CE41002:p.Glu894Lys | ||||||||
T01H8.5a.1:c.2863G>A | ||||||||
CE42821:p.Glu549Lys | ||||||||
CE41003:p.Glu854Lys | ||||||||
T01H8.5c.1:c.2680G>A | ||||||||
T01H8.5e.1:c.1645G>A | ||||||||
T01H8.5d.1:c.2560G>A | ||||||||
CE30390:p.Glu955Lys | ||||||||
HGVSg | CHROMOSOME_I:g.8555229C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T01H8 | ||||
Flanking_sequences | actgaaccagatttccgttatccgtacagt | aactcatgatatgggctgttttgacgaaaa | ||||||
Mapping_target | T01H8 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007128 | |||||||
WBStrain00007130 | ||||||||
WBStrain00049840 | ||||||||
WBStrain00049841 | ||||||||
Laboratory | JK | |||||||
Status | Live | |||||||
Linked_to | WBVar02147594 | |||||||
WBVar02147596 | ||||||||
WBVar02147597 | ||||||||
WBVar02147599 | ||||||||
WBVar02147601 | ||||||||
WBVar02147606 | ||||||||
Affects | Gene | WBGene00001651 | ||||||
Transcript | T01H8.5e.1 (12) | |||||||
T01H8.5a.1 (12) | ||||||||
T01H8.5d.1 (12) | ||||||||
T01H8.5c.1 (12) | ||||||||
T01H8.5d.2 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
SIFT | 0.01 | deleterious | ||||||
PolyPhen | 0.944 | possibly_damaging | ||||||
HGVSc | T01H8.5d.2:c.2560G>A | |||||||
HGVSp | CE41003:p.Glu854Lys | |||||||
cDNA_position | 2693 | |||||||
CDS_position | 2560 | |||||||
Protein_position | 854 | |||||||
Exon_number | 13/27 | |||||||
Codon_change | Gaa/Aaa | |||||||
Amino_acid_change | E/K | |||||||
Interactor | WBInteraction000050597 | |||||||
WBInteraction000050598 | ||||||||
WBInteraction000051953 | ||||||||
WBInteraction000051954 | ||||||||
WBInteraction000501216 | ||||||||
WBInteraction000501217 | ||||||||
WBInteraction000501218 | ||||||||
WBInteraction000501219 | ||||||||
WBInteraction000504554 | ||||||||
WBInteraction000517362 | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | I | 2.94713 | |||||
Description | Phenotype | WBPhenotype:0000688 | Paper_evidence | WBPaper00036046 | ||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | zygotic sterile at 25C, fertile 15C, upshift gives Gon progeny | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive (2) | |||||||
WBPhenotype:0000691 | Paper_evidence | WBPaper00036046 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mg2+ supplementation can partially suppress the gonadogenesis defect of gon-2 mutants. Supplementation of the medium with 50 mM Mg2+ increased the frequency of non-vulvaless gon-2(q388) animals raised at 23.5 deg C. from 12% (n=763) to 64% (n=968). | Paper_evidence | WBPaper00036046 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00036046 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00036046 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00036046 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000836 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | zygotic sterile at 25C, fertile 15C, upshift gives Gon progeny | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00018419 | |||||||
WBPaper00036046 | ||||||||
WBPaper00010677 | ||||||||
WBPaper00011070 | ||||||||
WBPaper00019720 | ||||||||
WBPaper00048884 | ||||||||
WBPaper00065340 | ||||||||
WBPaper00065841 | ||||||||
Method | Substitution_allele |