WormBase Tree Display for Variation: WBVar00241753
expand all nodes | collapse all nodes | view schema
WBVar00241753 | Evidence | Paper_evidence | WBPaper00048558 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | s180 | |||||
Other_name | s155 | Paper_evidence | WBPaper00000321 | ||||
CE33587:p.Gln29Ter | |||||||
Y18H1A.7a.1:c.85C>T | |||||||
HGVSg | CHROMOSOME_I:g.719551G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | Y18H1A | |||
Flanking_sequences | cgccgatttatcgccagccggccagttatc | agttcgatcggcgaccaggatacgttccga | |||||
Mapping_target | Y18H1A | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00048558 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00000478 | ||||||
WBStrain00000485 | |||||||
WBStrain00023684 | |||||||
WBStrain00023827 | |||||||
WBStrain00023828 | |||||||
WBStrain00023829 | |||||||
WBStrain00023830 | |||||||
WBStrain00023831 | |||||||
WBStrain00023832 | |||||||
WBStrain00023833 | |||||||
WBStrain00023834 | |||||||
WBStrain00023885 | |||||||
WBStrain00023900 | |||||||
WBStrain00023934 | |||||||
WBStrain00023937 | |||||||
WBStrain00023938 | |||||||
WBStrain00023939 | |||||||
WBStrain00023940 | |||||||
WBStrain00023943 | |||||||
WBStrain00023944 | |||||||
WBStrain00023945 | |||||||
WBStrain00023946 | |||||||
Laboratory | BC | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004332 | |||||
Transcript | Y18H1A.7a.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | Y18H1A.7a.1:c.85C>T | ||||||
HGVSp | CE33587:p.Gln29Ter | ||||||
cDNA_position | 345 | ||||||
CDS_position | 85 | ||||||
Protein_position | 29 | ||||||
Exon_number | 3/7 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
Genetics | Interpolated_map_position | I | -18.5548 | ||||
Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00032296 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Seven out of sixteen synapsed homolog pairs showed a ZHP-3 focus near the center of the chromosome, in contrast to four of five synapsed homolog pairs in wild-type animals with a ZHP-3 focus closer to one end. | Paper_evidence | WBPaper00032296 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000742 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | increases meiotic recombination in gene clusters, reduces recombination on chromosome arms; distribution of crossovers in Rec-1 approximates physical map. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed (2) | |||||||
Reference | WBPaper00000565 | ||||||
WBPaper00016442 | |||||||
WBPaper00032296 | |||||||
WBPaper00048558 | |||||||
Method | Substitution_allele |