WormBase Tree Display for Variation: WBVar00143969
expand all nodes | collapse all nodes | view schema
WBVar00143969 | Evidence | Paper_evidence | WBPaper00035610 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1393 | ||||||
Other_name | CE06236:p.Ser391Trp | |||||||
R05D11.1.1:c.1172C>A | ||||||||
CE06236:p.Ser391Ter | ||||||||
R05D11.1.1:c.1172C>G | ||||||||
HGVSg | CHROMOSOME_I:g.8585234G>T | |||||||
Sequence_details | SMap | S_parent | Sequence | R05D11 | ||||
Flanking_sequences | tatcaaaataacatcattacagccgtttct | gcttggttggtacaacaatccaaaccgctc | ||||||
Mapping_target | R05D11 | |||||||
Type_of_mutation | Substitution | c | r | Paper_evidence | WBPaper00035610 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00003964 | |||||||
WBStrain00003965 | ||||||||
WBStrain00003971 | ||||||||
WBStrain00004321 | ||||||||
WBStrain00006203 | ||||||||
WBStrain00006206 | ||||||||
WBStrain00006213 | ||||||||
WBStrain00006216 | ||||||||
WBStrain00006268 | ||||||||
WBStrain00006331 | ||||||||
WBStrain00006339 | ||||||||
WBStrain00006342 | ||||||||
WBStrain00008453 | ||||||||
WBStrain00030741 | ||||||||
WBStrain00030759 | ||||||||
WBStrain00035146 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects (3) | ||||||||
Genetics | Interpolated_map_position | I | 2.97492 | |||||
Mapping_data | In_2_point | 28 | ||||||
424 | ||||||||
703 | ||||||||
2509 | ||||||||
3738 | ||||||||
In_multi_point (20) | ||||||||
In_pos_neg_data | 2508 | |||||||
2510 | ||||||||
2511 | ||||||||
6821 | ||||||||
6824 | ||||||||
7283 | ||||||||
7286 | ||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutations in daf-8 confer an egg-laying defect | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000012 | Paper_evidence | WBPaper00000316 | ||||||
WBPaper00000504 | ||||||||
WBPaper00001923 | ||||||||
WBPaper00028386 | ||||||||
WBPaper00032073 | ||||||||
WBPaper00035610 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2021 | ||||||||
Remark | Recovered by selection for resistance to 1% SDS. | Paper_evidence | WBPaper00000504 | |||||
Curator_confirmed | WBPerson712 | |||||||
Weakly dominant for Dauer constitutive. | Paper_evidence | WBPaper00001923 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Animals formed 0% dauer at 16C. | Paper_evidence | WBPaper00028386 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Animals exhibited a moderate Daf-c phenotype at lower temperatures but is 100% Daf-c at 25C. | Paper_evidence | WBPaper00032073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
The temperature sensitive Daf-c phenotype is most penetrant at 25.5C | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
weak allele | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000316 | ||||||
WBPaper00000504 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000316 | ||||
WBPaper00000504 | ||||||||
WBPaper00028386 | ||||||||
WBPaper00032073 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
25.5 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 16 | Paper_evidence | WBPaper00028386 | ||||
Curator_confirmed | WBPerson712 | |||||||
25, 20, 15 | Paper_evidence | WBPaper00032073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-4(e120) | Paper_evidence | WBPaper00028386 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutations in daf-8 confer reduced brood size | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00032073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The expression of cuIs5 (or cuIs2), a reporter of TGF-beta -signaling activity, is reduced compared to wild type levels. | Paper_evidence | WBPaper00032073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | cuIs5 or cuIs2 | Paper_evidence | WBPaper00032073 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000545 | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00032501 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants had enhanced susceptibility to killing by PA14 than N2 | Paper_evidence | WBPaper00032501 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001033 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The mitotic zone was significantly extended in daf-8(e1393) | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001690 | Paper_evidence | WBPaper00002589 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals bind mAb M37 at stages L1-L4 but not as adults, wildtype worms only bind this anti-body at the L1 stage. Animals in dauer stage do not bind mAb 37, similar to wildtype. | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | High | Pentrance ranged from 87-100%. | Paper_evidence | WBPaper00002589 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00002589 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 16, 25 | Paper_evidence | WBPaper00002589 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0004016 | Paper_evidence | WBPaper00050708 | ||||||
Curator_confirmed | WBPerson14035 | |||||||
Phenotype_not_observed | WBPhenotype:0001068 | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Treatment | 5 mg/ml serotonin | Paper_evidence | WBPaper00000635 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00000635 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (13) | ||||||||
Method | Substitution_allele |