WormBase Tree Display for Variation: WBVar00143302
expand all nodes | collapse all nodes | view schema
WBVar00143302 | Evidence | Paper_evidence | WBPaper00027361 | ||
---|---|---|---|---|---|
Name | Public_name | e565 | |||
Sequence_details | SMap | S_parent | Sequence | F27C1 | |
Flanking_sequences | catctttttccacaataagtgctcatgtgc | tttcctttttcttttgaacttgctaacttt | |||
Mapping_target | F27C1 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00001067 | |||
Genetics | Interpolated_map_position | I | 0.000268718 | ||
Reference | WBPaper00015468 | ||||
WBPaper00013926 | |||||
Remark | Mutation lies upstream of gene. | ||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001067 Genomic_neighbourhood | Paper_evidence | WBPaper00027361 | |||
Method | Deletion_allele |