WormBase Tree Display for Variation: WBVar00144590
expand all nodes | collapse all nodes | view schema
WBVar00144590 | Evidence | Paper_evidence (2) | ||||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e2141 | ||||||
Other_name | F02A9.6.1:c.2920C>T | |||||||
CE00237:p.Arg974Cys | ||||||||
HGVSg | CHROMOSOME_III:g.9098313C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F02A9 | ||||
Flanking_sequences | actgctctgatgctagctgttcgtgcacac | gtgtcagactttccgtagtgcttcttcgtg | ||||||
Mapping_target | F02A9 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00038033 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (50) | ||||||||
Laboratory | CB | |||||||
AA | ||||||||
SHU | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001609 | ||||||
Transcript | F02A9.6.1 (12) | |||||||
Interactor (74) | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | III | 0.163959 | |||||
Mapping_data | In_multi_point | 1508 | ||||||
Description | Phenotype (21) | |||||||
Phenotype_not_observed | WBPhenotype:0000207 | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | glp-1(e2141ts) mutants exhibited normal defectation rates at the non-permissive temperature of 25 degrees Celsius, compared to wild type controls (Figure 1J) | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | For defecation rate, 2-day-old well-fed adults after temperature shift at L4 larval stage were monitored. For each animal, the duration of two consecutive cycles was recorded 5 times and the average of ~5-10 animals is presented for each genotype. | Paper_evidence | WBPaper00032310 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Temperature | 25 | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001006 | Paper_evidence | WBPaper00032310 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | glp-1(e2141ts) mutants exhibited normal pharyngeal pumping rates at the non-permissive temperature of 25 degrees Celsius, compared to wild type controls (Figure 1H) | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | For pharyngeal pumping rate, 2-day-old well-fed adults after temperature shift at L4 larval stage were recorded with a video camera for 5 minutes. The number of pharyngeal contractions in each second interval was calculated. For each genotype, the average of ~15-20 animals was noted. | Paper_evidence | WBPaper00032310 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Temperature | 25 | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00032310 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | glp-1(e2141ts) mutants exhibited normal fat content at the permissive temperature of 20 degrees Celsius, compared to wild type controls, as determined by Nile Red staining (Figure S3A,B) | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00032310 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001266 | Paper_evidence | WBPaper00035490 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Nematodes containing a mutation in either glp-1 or glp-4 did not have substantially more phospho-PMK-1 than did wild-type nematodes | Paper_evidence | WBPaper00035490 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001381 | Paper_evidence | WBPaper00046527 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | glp-1(e2141) mutant worms were not resistant to anoxia exposure when fed a glucose-supplemented diet (Figure S1B) | Paper_evidence | WBPaper00046527 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003916 | Paper_evidence | WBPaper00046527 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001800 | Paper_evidence | WBPaper00035490 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glp-1 mutation did not significantly alter expression of four putative antimicrobial genes (lys-8, clec-85, dod-22, and K08D8.5) when the nematodes were exposed to pathogenic bacterium | Paper_evidence | WBPaper00035490 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0002271 | Paper_evidence | WBPaper00032310 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | glp-1(e2141ts) mutants exhibited normal food absorption rates at the non-permissive temperature of 25 degrees Celsius, compared to wild type controls (Figure 1I) | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Food absorption rate were measured as in O'Rourke et al. (in preparation). Briefly, 2-day old animals were placed onto C1-BODIPY-C12-containing NGM plates. After a 6 hour incubation in darkness, fluorescence images were captured every hour for 4 hours. C1-BODIPY-C12 staining fluorescence was quantified. The accumulation rate of C1-BODIPY-C12 overtime was calculated for both wild type and glp-1 mutants. The values of the mutants were then normalized to wild type. For each genotype at each time point, the average of 5 animals was noted. | Paper_evidence | WBPaper00032310 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Temperature | 25 | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004025 | Paper_evidence | WBPaper00032310 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | glp-1(e2141ts) mutants exhibited normal mean velocity at the non-permissive temperature of 25 degrees Celsius, compared to wild type controls (Figure 1K) | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | 10 3-day-old well-fed adults after temperature shift at L4 larval stage were placed onto a fresh NGM plate seeded with 50 microliters of OP50 bacteria. 5 minutes Digital videos were captured using Zeiss Discovery V.12 stereoscope, Zeiss AxioCam Hsc camera and AxioVision software. Each individual was followed by the "worm tracking" function with the AxioVision software to quantify velocity. For each genotype, 3 plates were prepared to take videos and 20 individuals' activities were analyzed. | Paper_evidence | WBPaper00032310 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Temperature | 25 | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00001930 | |||||||
WBPaper00040076 | ||||||||
WBPaper00040161 | ||||||||
WBPaper00032232 | ||||||||
WBPaper00036472 | ||||||||
WBPaper00011714 | ||||||||
WBPaper00021884 | ||||||||
WBPaper00027157 | ||||||||
WBPaper00031997 | ||||||||
WBPaper00032310 | ||||||||
WBPaper00035490 | ||||||||
WBPaper00031903 | ||||||||
WBPaper00013892 | ||||||||
WBPaper00001008 | ||||||||
WBPaper00016588 | ||||||||
WBPaper00016490 | ||||||||
WBPaper00038033 | ||||||||
WBPaper00045103 | ||||||||
WBPaper00046527 | ||||||||
WBPaper00061997 | ||||||||
WBPaper00065315 | ||||||||
WBPaper00065793 | ||||||||
WBPaper00065993 | ||||||||
Remark | In addition to the curated substitution, e2141 also has an a to g substitution with flanking sequences atcaaaagagcaggatctcgaaaaacgcca & caagtgcagcatcgtctcgcgaaacaaatc | Paper_evidence | WBPaper00038033 | |||||
Contrary to what was previously thought and published (Kodoyianni et al., 1992 and also in WormBase), e2141 and e2144 do not bear the same sequence change. e2141 actually carries two mutations in exon 8: c2920t and a3610g. | ||||||||
Method | Substitution_allele |