WormBase Tree Display for Variation: WBVar00143035
expand all nodes | collapse all nodes | view schema
WBVar00143035 | Evidence | Paper_evidence | WBPaper00004275 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | ||||
Flanking_sequences | agctgagcaaattcgacgatggcgatctat | gattgtactgaatagtggagaaatggcatt | ||||||
Mapping_target | JC8 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004127 | |||||||
WBStrain00005395 | ||||||||
WBStrain00006188 | ||||||||
WBStrain00008016 | ||||||||
WBStrain00026968 | ||||||||
WBStrain00027061 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006763 | ||||||
Transcript | JC8.10b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | JC8.10b.1:c.2708G>A | |||||||
HGVSp | CE29050:p.Trp903Ter | |||||||
cDNA_position | 2713 | |||||||
CDS_position | 2708 | |||||||
Protein_position | 903 | |||||||
Exon_number | 10/12 | |||||||
Codon_change | tGg/tAg | |||||||
Amino_acid_change | W/* | |||||||
JC8.10a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | JC8.10a.1:c.2690G>A | |||||||
HGVSp | CE28239:p.Trp897Ter | |||||||
cDNA_position | 2693 | |||||||
CDS_position | 2690 | |||||||
Protein_position | 897 | |||||||
Exon_number | 9/11 | |||||||
Codon_change | tGg/tAg | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000517566 | |||||||
WBInteraction000517568 | ||||||||
Genetics (2) | ||||||||
Description | Phenotype (18) | |||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||
WBPaper00040857 | ||||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
Mutation did not cause SNB-1::VENUS localization defects. | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040857 | |||||||
WBPaper00001709 | ||||||||
WBPaper00028886 | ||||||||
WBPaper00000031 | ||||||||
WBPaper00004883 | ||||||||
WBPaper00004275 | ||||||||
WBPaper00016536 | ||||||||
WBPaper00017000 | ||||||||
WBPaper00013791 | ||||||||
WBPaper00001303 | ||||||||
WBPaper00048427 | ||||||||
WBPaper00048926 | ||||||||
Method | Substitution_allele |