WormBase Tree Display for Variation: WBVar00142951
expand all nodes | collapse all nodes | view schema
WBVar00142951 | Evidence | Paper_evidence | WBPaper00003560 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e81 | |||||
Other_name | CE24927:p.Gln520Ter | ||||||
F27D9.1a.1:c.1558C>T | |||||||
HGVSg | CHROMOSOME_X:g.7685018C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C53C9 | |||
Flanking_sequences | ttcagagcccctgcatctgctagatatggt | agtggcacaaggaacgaggacaacaatcca | |||||
Mapping_target | C53C9 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003560 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004094 | ||||||
WBStrain00007165 | |||||||
WBStrain00026732 | |||||||
WBStrain00026853 | |||||||
WBStrain00030690 | |||||||
WBStrain00033537 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006757 | |||||
Transcript | F27D9.1a.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F27D9.1a.1:c.1558C>T | ||||||
HGVSp | CE24927:p.Gln520Ter | ||||||
cDNA_position | 1594 | ||||||
CDS_position | 1558 | ||||||
Protein_position | 520 | ||||||
Exon_number | 10/11 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
Interactor | WBInteraction000503689 | ||||||
WBInteraction000504904 | |||||||
WBInteraction000517392 | |||||||
WBInteraction000518362 | |||||||
Genetics (2) | |||||||
Description (2) | |||||||
Reference | WBPaper00038267 | ||||||
WBPaper00040284 | |||||||
WBPaper00043908 | |||||||
WBPaper00029020 | |||||||
WBPaper00001709 | |||||||
WBPaper00028886 | |||||||
WBPaper00032446 | |||||||
WBPaper00000031 | |||||||
WBPaper00004883 | |||||||
WBPaper00013904 | |||||||
WBPaper00025822 | |||||||
WBPaper00017045 | |||||||
WBPaper00032378 | |||||||
WBPaper00048427 | |||||||
WBPaper00050142 | |||||||
WBPaper00065262 | |||||||
Remark | Sequencing of the CB81 strain indicates that this mutation is a Q520stop, not Q530stop as described in the paper. | Person_evidence | WBPerson6467 | ||||
Method | Substitution_allele |