WormBase Tree Display for Variation: WBVar00142951
expand all nodes | collapse all nodes | view schema
| WBVar00142951 | Evidence | Paper_evidence | WBPaper00003560 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e81 | |||||
| Other_name | CE24927:p.Gln520Ter | ||||||
| F27D9.1a.1:c.1558C>T | |||||||
| HGVSg | CHROMOSOME_X:g.7685018C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C53C9 | |||
| Flanking_sequences | ttcagagcccctgcatctgctagatatggt | agtggcacaaggaacgaggacaacaatcca | |||||
| Mapping_target | C53C9 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003560 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004094 | ||||||
| WBStrain00007165 | |||||||
| WBStrain00026732 | |||||||
| WBStrain00026853 | |||||||
| WBStrain00030690 | |||||||
| WBStrain00033537 | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006757 | |||||
| Transcript | F27D9.1a.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F27D9.1a.1:c.1558C>T | ||||||
| HGVSp | CE24927:p.Gln520Ter | ||||||
| cDNA_position | 1594 | ||||||
| CDS_position | 1558 | ||||||
| Protein_position | 520 | ||||||
| Exon_number | 10/11 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| Interactor | WBInteraction000503689 | ||||||
| WBInteraction000504904 | |||||||
| WBInteraction000517392 | |||||||
| WBInteraction000518362 | |||||||
| Genetics (2) | |||||||
| Description (2) | |||||||
| Reference | WBPaper00038267 | ||||||
| WBPaper00040284 | |||||||
| WBPaper00043908 | |||||||
| WBPaper00029020 | |||||||
| WBPaper00001709 | |||||||
| WBPaper00028886 | |||||||
| WBPaper00032446 | |||||||
| WBPaper00000031 | |||||||
| WBPaper00004883 | |||||||
| WBPaper00013904 | |||||||
| WBPaper00025822 | |||||||
| WBPaper00017045 | |||||||
| WBPaper00032378 | |||||||
| WBPaper00048427 | |||||||
| WBPaper00050142 | |||||||
| WBPaper00065262 | |||||||
| Remark | Sequencing of the CB81 strain indicates that this mutation is a Q520stop, not Q530stop as described in the paper. | Person_evidence | WBPerson6467 | ||||
| Method | Substitution_allele |
