WormBase Tree Display for Variation: WBVar00142924
expand all nodes | collapse all nodes | view schema
WBVar00142924 | Evidence | Paper_evidence | WBPaper00025184 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e30 | ||||||
Other_name (12) | ||||||||
HGVSg | CHROMOSOME_V:g.11908351G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | R31 | ||||
Flanking_sequences | caagaagcaggaagcactcagaaccgcatg | aacacactgtgtgaatacatcgaagcacgt | ||||||
Mapping_target | R31 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00025184 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (14) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004855 | ||||||
Transcript | R31.1e.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | R31.1e.1:c.5889G>A | |||||||
HGVSp | CE52987:p.Trp1963Ter | |||||||
cDNA_position | 5889 | |||||||
CDS_position | 5889 | |||||||
Protein_position | 1963 | |||||||
Exon_number | 8/17 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
R31.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R31.1a.1:c.5889G>A | |||||||
HGVSp | CE41581:p.Trp1963Ter | |||||||
cDNA_position | 6004 | |||||||
CDS_position | 5889 | |||||||
Protein_position | 1963 | |||||||
Exon_number | 9/20 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
R31.1c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R31.1c.1:c.5331G>A | |||||||
HGVSp | CE46009:p.Trp1777Ter | |||||||
cDNA_position | 5331 | |||||||
CDS_position | 5331 | |||||||
Protein_position | 1777 | |||||||
Exon_number | 5/15 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
R31.1b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R31.1b.1:c.5580G>A | |||||||
HGVSp | CE27773:p.Trp1860Ter | |||||||
cDNA_position | 5580 | |||||||
CDS_position | 5580 | |||||||
Protein_position | 1860 | |||||||
Exon_number | 7/17 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
R31.1d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R31.1d.1:c.5580G>A | |||||||
HGVSp | CE46252:p.Trp1860Ter | |||||||
cDNA_position | 5822 | |||||||
CDS_position | 5580 | |||||||
Protein_position | 1860 | |||||||
Exon_number | 8/18 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
R31.1f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R31.1f.1:c.5331G>A | |||||||
HGVSp | CE53064:p.Trp1777Ter | |||||||
cDNA_position | 5331 | |||||||
CDS_position | 5331 | |||||||
Protein_position | 1777 | |||||||
Exon_number | 5/14 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000500863 | |||||||
Genetics | Interpolated_map_position | V | 3.53978 | |||||
Mapping_data | In_2_point (12) | |||||||
In_multi_point (74) | ||||||||
In_pos_neg_data | 296 | |||||||
852 | ||||||||
867 | ||||||||
1742 | ||||||||
1754 | ||||||||
1815 | ||||||||
2130 | ||||||||
3408 | ||||||||
6770 | ||||||||
6869 | ||||||||
Description | Phenotype | WBPhenotype:0000071 | Paper_evidence | WBPaper00000031 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | larvae have shortened, round heads | Paper_evidence | WBPaper00000031 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000229 | Paper_evidence (3) | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
WBPerson415 | ||||||||
Remark | Double mutants of show additive effects. | Paper_evidence | WBPaper00038069 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000322 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | round-headed, especially in early larvae | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000324 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | short, especially in early larvae | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00061063 | ||||||
Curator_confirmed | WBPerson172 | |||||||
Remark | Fig 2B | Paper_evidence | WBPaper00061063 | |||||
Curator_confirmed | WBPerson172 | |||||||
WBPhenotype:0000645 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | adults have slight rolling tendency | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | animals exhibited the same defects observed in iv38 homozygotes | Paper_evidence | WBPaper00040002 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_not_observed | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038069 | |||||||
WBPaper00040002 | ||||||||
WBPaper00000031 | ||||||||
WBPaper00004883 | ||||||||
WBPaper00016467 | ||||||||
WBPaper00015411 | ||||||||
WBPaper00016343 | ||||||||
WBPaper00016454 | ||||||||
WBPaper00016578 | ||||||||
WBPaper00018043 | ||||||||
WBPaper00013997 | ||||||||
WBPaper00021645 | ||||||||
WBPaper00003094 | ||||||||
WBPaper00060633 | ||||||||
WBPaper00061063 | ||||||||
Method | Substitution_allele |