WormBase Tree Display for Variation: WBVar00089401
expand all nodes | collapse all nodes | view schema
WBVar00089401 | Evidence | Paper_evidence | WBPaper00004442 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n301 | |||||||
Other_name | K10G6.1.1:c.185G>A | ||||||||
CE12098:p.Arg62Gln | |||||||||
HGVSg | CHROMOSOME_II:g.3983472G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | K10G6 | |||||
Flanking_sequences | gtaatgttttcaggtggcaaaactccctgc | acacaacttgtcattcaacgactgcttcat | |||||||
Mapping_target | K10G6 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00003017 | |||||||
Transcript | K10G6.1.1 (12) | ||||||||
Interactor | WBInteraction000052119 | ||||||||
WBInteraction000500693 | |||||||||
WBInteraction000500697 | |||||||||
WBInteraction000501874 | |||||||||
WBInteraction000524414 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | II | -5.88214 | ||||||
Mapping_data | In_2_point | 783 | |||||||
784 | |||||||||
In_multi_point (14) | |||||||||
In_pos_neg_data (13) | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 21% of fertile animals (n=33) exhibited an egg laying defect. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000216 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | defect in Bγ cell fate specification | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0001708 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000218 | Paper_evidence | WBPaper00026707 | |||||||
WBPaper00005344 | |||||||||
WBPaper00006388 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | 4.3 (n=17) | Paper_evidence | WBPaper00026707 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
The lin-31(n301) mutation resulted in more than the expected number of induced vulval precursor cells (4.45 on average instead of 3.0 in wild type) | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
lin-31(n301) mutant animals exhibited an average of 3.81 induced vulval precursor cells (Table I), as opposed to 3.0 in wild type | Paper_evidence | WBPaper00006388 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00005344 | ||||
WBPaper00006388 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000239 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | VPC cells adopt 1ary/2ary/3ary fate at random. Similar phenotype in n301/Df. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000296 | Paper_evidence | WBPaper00003626 | |||||||
Curator_confirmed | WBPerson37 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00026707 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 33% (n=212) | Paper_evidence | WBPaper00026707 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00026863 | |||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | 33% animals (n=21) are aberrant in induction of VPCs; <3 of the VPCs, which are induced in wild type animals (P5.p to P7.p), are induced in these animals, as scored by Nomarski optics. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
5% of lin-31(n301) animals are vulvaless | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Probable_null_via_phenotype | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00005344 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00000762 | |||||||
WBPaper00026863 | |||||||||
WBPaper00026707 | |||||||||
WBPaper00005344 | |||||||||
WBPaper00006388 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark | Vulva is non-functional in some lin-31 hermaphrodites, which results in a bag of worms phenotype | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
86% animals display one or more ectopic pseudovulvae (n=314). | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Adult hermaphrodite Muv, vulva either functional or nonfunctional protrusion; 0-4 small ventral protrusions. Similar phenotype in n301/Df. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
95% of lin-31(n301) animals have multiple vulva | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table I | Paper_evidence | WBPaper00006388 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 74% (n=472) | Paper_evidence | WBPaper00026707 | |||||
Curator_confirmed | WBPerson712 | ||||||||
High | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
90% penetrant | Paper_evidence | WBPaper00006388 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00000762 | ||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson2987 | |||||||||
Probable_null_via_phenotype | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00005344 | ||||
WBPaper00006388 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | decreased sIys145 expression in Bγ | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0010467 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | male mating is completely abolished | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1467) | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000099 | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-31(n301) mutation did not result in any animals with the '0 P11.p' phenotype (P11 adopts a P12 fate) or the '2 P11.p' phenotype (P12 adopts a P11 fate) | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000170 | Paper_evidence | WBPaper00026707 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00026707 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | <1% (n=337) | Paper_evidence | WBPaper00026707 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% animals produced progeny (n=33). | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00038408 | |||||||
WBPaper00004481 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | arIs131[lag-2p::2Xnls::yfp] is expressed specifically in P6.p in a lin-31(0) null mutant, as in wild type; arIs131[lag-2p::2nls-yfp::unc-54 3'UTR] expression remains P6.p specific. | Paper_evidence | WBPaper00038408 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
"In a lin-31 mutant background, VPCs adopt vulval or non-vulval fates randomly, although P6.p is always the closest VPC to the AC. We scored the patterning of P6.p descendants only when P6.p adopted the 1° fate (scored according to detachment of the descendants from ventral cuticle and symmetry of invagination; Katz et al., 1995), and found that it displayed the wild-type zmp-1::GFP expression pattern in its progeny in all cases (n=31 animals, Table 5). Therefore, lin-31 is likely not required during 1° lineage patterning." | Paper_evidence | WBPaper00004481 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00004481 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | syIs49 [zmp-1::GFP] | Paper_evidence | WBPaper00004481 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001024 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male gross morphology wildtype. Similar phenotype in n301/Df. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038408 | ||||||||
WBPaper00027266 | |||||||||
WBPaper00005344 | |||||||||
WBPaper00035553 | |||||||||
WBPaper00003626 | |||||||||
WBPaper00015606 | |||||||||
WBPaper00015357 | |||||||||
WBPaper00026707 | |||||||||
WBPaper00000762 | |||||||||
WBPaper00014208 | |||||||||
WBPaper00004481 | |||||||||
WBPaper00026863 | |||||||||
WBPaper00006388 | |||||||||
Method | Substitution_allele |