WormBase Tree Display for Variation: WBVar00088574
expand all nodes | collapse all nodes | view schema
WBVar00088574 | Evidence | Paper_evidence | WBPaper00003977 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | m86 | |||||||
Other_name | CE02205:p.Arg88Ter | ||||||||
F33H1.1e.1:c.262C>T | |||||||||
CE43609:p.Arg111Ter | |||||||||
F33H1.1c.1:c.214C>T | |||||||||
F33H1.1a.1:c.688C>T | |||||||||
F33H1.1b.1:c.763C>T | |||||||||
CE17763:p.Arg230Ter | |||||||||
CE01567:p.Arg72Ter | |||||||||
F33H1.1d.1:c.331C>T | |||||||||
CE28019:p.Arg255Ter | |||||||||
HGVSg | CHROMOSOME_II:g.10160814G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F33H1 | |||||
Flanking_sequences | gcagactcgatcaacttgccgaacaatcaa | gagcttcccccgcaacggtatgaataaaac | |||||||
Mapping_target | F33H1 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003977 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (34) | |||||||||
Laboratory | DR | ||||||||
JT | |||||||||
NFB | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000914 | |||||||
Transcript (5) | |||||||||
Interactor (54) | |||||||||
Genetics | Interpolated_map_position | II | 2.13278 | ||||||
Mapping_data (3) | |||||||||
Description | Phenotype (19) | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult lifespan was not increased. Animals were allowed to progress through development at 15 degrees C. then shifted to 25.5 degrees C. to determine lifespan. | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were raised at 15C and placed at 25.5C as L4 larvae or young adults for the life span assay. | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25.5C | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00035062 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In daf-19(m86) mutants, HYLS-1 localization was unaffected | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00003977 | |||||||
Curator_confirmed | WBPerson641 | ||||||||
Remark | Table 2, Figure1; concerns the microvilli at the dendritic tips of the thermosensory AFD neurons | Paper_evidence | WBPaper00003977 | ||||||
Curator_confirmed | WBPerson641 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00003977 | ||||
Curator_confirmed | WBPerson641 | ||||||||
GO_term | GO:0005902 | PATO:0000460 | Paper_evidence | WBPaper00003977 | |||||
Curator_confirmed | WBPerson641 | ||||||||
GO:0030425 | PATO:0000460 | Paper_evidence | WBPaper00003977 | ||||||
Curator_confirmed | WBPerson641 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | CEP does not stain with FITC at permissive or non-permissive temperatures. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005107 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C, 25C | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of ADE or PDE. | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00011721 | ||||||||
WBPaper00017206 | |||||||||
WBPaper00039866 | |||||||||
WBPaper00022085 | |||||||||
WBPaper00022742 | |||||||||
WBPaper00000932 | |||||||||
WBPaper00014950 | |||||||||
WBPaper00002149 | |||||||||
WBPaper00035071 | |||||||||
WBPaper00031936 | |||||||||
WBPaper00029016 | |||||||||
WBPaper00006052 | |||||||||
WBPaper00003977 | |||||||||
WBPaper00032252 | |||||||||
WBPaper00037652 | |||||||||
WBPaper00014661 | |||||||||
WBPaper00035062 | |||||||||
WBPaper00014968 | |||||||||
WBPaper00050371 | |||||||||
WBPaper00055368 | |||||||||
WBPaper00061932 | |||||||||
WBPaper00065298 | |||||||||
WBPaper00065747 | |||||||||
WBPaper00004071 | |||||||||
Remark | |||||||||
Method | Substitution_allele |