WormBase Tree Display for Variation: WBVar00142938
expand all nodes | collapse all nodes | view schema
WBVar00142938 | Evidence | Paper_evidence | WBPaper00006005 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e55 | ||||||
Other_name (30) | ||||||||
HGVSg | CHROMOSOME_X:g.2723343G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | T02C5 | ||||
Flanking_sequences | agacggcgagccgctaataaaaagttaaaa | aagcctcaaaacagcagtctacagaaactg | ||||||
Mapping_target | T02C5 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006005 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (14) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006742 | ||||||
Transcript | T02C5.5g.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5g.1:c.1462C>T | |||||||
HGVSp | CE51886:p.Gln488Ter | |||||||
cDNA_position | 1462 | |||||||
CDS_position | 1462 | |||||||
Protein_position | 488 | |||||||
Exon_number | 8/29 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5q.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5q.1:c.1246C>T | |||||||
HGVSp | CE52709:p.Gln416Ter | |||||||
cDNA_position | 1246 | |||||||
CDS_position | 1246 | |||||||
Protein_position | 416 | |||||||
Exon_number | 8/28 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5j.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5j.1:c.1267C>T | |||||||
HGVSp | CE51856:p.Gln423Ter | |||||||
cDNA_position | 1267 | |||||||
CDS_position | 1267 | |||||||
Protein_position | 423 | |||||||
Exon_number | 8/29 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5o.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5o.1:c.1648C>T | |||||||
HGVSp | CE52764:p.Gln550Ter | |||||||
cDNA_position | 1648 | |||||||
CDS_position | 1648 | |||||||
Protein_position | 550 | |||||||
Exon_number | 12/32 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5f.1:c.1462C>T | |||||||
HGVSp | CE51879:p.Gln488Ter | |||||||
cDNA_position | 1462 | |||||||
CDS_position | 1462 | |||||||
Protein_position | 488 | |||||||
Exon_number | 8/30 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5h.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5h.1:c.1462C>T | |||||||
HGVSp | CE51907:p.Gln488Ter | |||||||
cDNA_position | 1462 | |||||||
CDS_position | 1462 | |||||||
Protein_position | 488 | |||||||
Exon_number | 8/29 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5c.1:c.994C>T | |||||||
HGVSp | CE51899:p.Gln332Ter | |||||||
cDNA_position | 994 | |||||||
CDS_position | 994 | |||||||
Protein_position | 332 | |||||||
Exon_number | 6/28 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5p.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5p.1:c.1804C>T | |||||||
HGVSp | CE52692:p.Gln602Ter | |||||||
cDNA_position | 1804 | |||||||
CDS_position | 1804 | |||||||
Protein_position | 602 | |||||||
Exon_number | 14/34 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5k.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5k.1:c.1267C>T | |||||||
HGVSp | CE51839:p.Gln423Ter | |||||||
cDNA_position | 1267 | |||||||
CDS_position | 1267 | |||||||
Protein_position | 423 | |||||||
Exon_number | 8/28 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5m.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5m.1:c.1267C>T | |||||||
HGVSp | CE51867:p.Gln423Ter | |||||||
cDNA_position | 1267 | |||||||
CDS_position | 1267 | |||||||
Protein_position | 423 | |||||||
Exon_number | 8/28 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5l.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5l.1:c.1267C>T | |||||||
HGVSp | CE51857:p.Gln423Ter | |||||||
cDNA_position | 1267 | |||||||
CDS_position | 1267 | |||||||
Protein_position | 423 | |||||||
Exon_number | 8/29 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5a.1:c.994C>T | |||||||
HGVSp | CE51900:p.Gln332Ter | |||||||
cDNA_position | 994 | |||||||
CDS_position | 994 | |||||||
Protein_position | 332 | |||||||
Exon_number | 6/21 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5n.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5n.1:c.1672C>T | |||||||
HGVSp | CE52755:p.Gln558Ter | |||||||
cDNA_position | 1672 | |||||||
CDS_position | 1672 | |||||||
Protein_position | 558 | |||||||
Exon_number | 12/32 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5i.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5i.1:c.1462C>T | |||||||
HGVSp | CE51840:p.Gln488Ter | |||||||
cDNA_position | 1462 | |||||||
CDS_position | 1462 | |||||||
Protein_position | 488 | |||||||
Exon_number | 8/28 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
T02C5.5b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T02C5.5b.1:c.1372C>T | |||||||
HGVSp | CE34980:p.Gln458Ter | |||||||
cDNA_position | 1428 | |||||||
CDS_position | 1372 | |||||||
Protein_position | 458 | |||||||
Exon_number | 9/30 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor (5) | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | X | -13.8024 | |||||
Mapping_data | In_2_point | 154 | ||||||
3151 | ||||||||
In_multi_point (14) | ||||||||
In_pos_neg_data (18) | ||||||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0001182 | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants had wild-type fat content | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Fat content was visualized by Nile red staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 and gcy-7 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6, otIs3 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001811 | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00022744 | |||||||
WBPaper00039901 | ||||||||
WBPaper00039865 | ||||||||
WBPaper00040284 | ||||||||
WBPaper00001709 | ||||||||
WBPaper00000031 | ||||||||
WBPaper00006052 | ||||||||
WBPaper00019070 | ||||||||
WBPaper00031915 | ||||||||
WBPaper00003760 | ||||||||
WBPaper00003955 | ||||||||
WBPaper00014960 | ||||||||
WBPaper00029404 | ||||||||
WBPaper00006005 | ||||||||
WBPaper00018051 | ||||||||
WBPaper00015459 | ||||||||
WBPaper00023702 | ||||||||
WBPaper00042396 | ||||||||
WBPaper00045955 | ||||||||
WBPaper00048388 | ||||||||
WBPaper00065262 | ||||||||
Remark | Resequencing of e55 places the lesion at Q(458) (in isoform T02C5.5b) with flanks of agacggcgagccgctaataaaaagttaaaa & aagcctcaaaacagcagtctacagaaactg | Person_evidence | WBPerson12335 | |||||
Laboratory_evidence | KG | |||||||
Following genotyping from the CGC we are updating the flanking sequences to follow both the reported update from 2011 and those now supplied by the CGC. Old flanks [tgttgccattcagttggaaaattcatcaaa aactgaggtaagaataaataatagtgtttt]. | Person_evidence | WBPerson2207 | ||||||
Curator_confirmed | WBPerson1983 | |||||||
Method | Substitution_allele |