WormBase Tree Display for Variation: WBVar00089919
expand all nodes | collapse all nodes | view schema
WBVar00089919 | Evidence | Paper_evidence | WBPaper00001366 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1046 | |||||||
Other_name | ZK792.6.1:c.38G>A | ||||||||
CE03827:p.Gly13Glu | |||||||||
HGVSg | CHROMOSOME_IV:g.11691040C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK792 | |||||
Flanking_sequences | agtacaagcttgtggtagttggagatggag | agttggtaaatcagcactcaccattcaact | |||||||
Mapping_target | ZK792 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001366 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (16) | |||||||||
Component_of_genotype | WBGenotype00000028 | ||||||||
WBGenotype00000029 | |||||||||
WBGenotype00000030 | |||||||||
WBGenotype00000038 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002335 | |||||||
Transcript | ZK792.6.1 (12) | ||||||||
Interactor (69) | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00001366 | |||||
Genetics (2) | |||||||||
Description | Phenotype (15) | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00002935 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | n1046 did not affect life span. | Paper_evidence | WBPaper00002935 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 1.6% progeny (n=613) fail to hatch, compared to 1.3% progeny of wild type (n=525) that failed to hatch. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00026863 | |||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | 1.3% animals die during larval development (n=603), compared to 0% (n=518) wild type animals larval lethality. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000099 | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The let-6(n1046) mutation did not result in any animals with the '0 P11.p' phenotype (P11 adopts a P12 fate) or the '2 P11.p' phenotype (P12 adopts a P11 fate) | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000147 | Paper_evidence | WBPaper00040181 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Short-term starvation was able to deplete the intestinal lipids of let-60(n1046 gf) worms. | Paper_evidence | WBPaper00040181 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00040181 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000245 | Paper_evidence | WBPaper00036021 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00031318 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants have a diphosphorylated activated form of MPK-1 (dpMPK-1) accumulation pattern indistinguishable from wild type. | Paper_evidence | WBPaper00031318 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031318 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00026707 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | <1% (n=191) | Paper_evidence | WBPaper00026707 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00026863 | |||||||
WBPaper00031318 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 100% animals produced progeny (n=42). | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Mutants are fertile at 15, 20, and 25 deg C. | Paper_evidence | WBPaper00031318 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
WBPaper00031318 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00026863 | |||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | 0% animals (n=46) are aberrant in induction of VPCs. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00003955 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004538 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005671 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001024 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male gross morphology wildtype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00003955 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00057074 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | neurons did not show a loss in unc-25::GFP expression | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014913 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005027 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005021 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001668 | Paper_evidence | WBPaper00031914 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals 24 or 48 hours post-L4 stage did not exhibit a significant increase in oocytes compared to wild-type animals. | Paper_evidence | WBPaper00031914 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031914 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:162 | |||||||
DOID:0080690 | |||||||||
Models_disease_in_annotation | WBDOannot00000779 | ||||||||
WBDOannot00000854 | |||||||||
Reference (73) | |||||||||
Method | Substitution_allele |