WormBase Tree Display for Variation: WBVar00088536
expand all nodes | collapse all nodes | view schema
WBVar00088536 | Evidence | Paper_evidence | WBPaper00004181 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | m20 | |||||||
Other_name (15) | |||||||||
HGVSg | CHROMOSOME_X:g.10661711G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F11A1 | |||||
Flanking_sequences | atgcttcacagttggtatgaaaaaagagtg | attttaaacgaagaacaactgcggcggagg | |||||||
Mapping_target | F11A1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004181 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006154 | ||||||||
WBStrain00006224 | |||||||||
WBStrain00006356 | |||||||||
Laboratory | DR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000908 | |||||||
Transcript | F11A1.3b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3b.1:c.384G>A | ||||||||
HGVSp | CE27585:p.Trp128Ter | ||||||||
cDNA_position | 384 | ||||||||
CDS_position | 384 | ||||||||
Protein_position | 128 | ||||||||
Exon_number | 4/15 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F11A1.3e.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3e.2:c.384G>A | ||||||||
HGVSp | CE54230:p.Trp128Ter | ||||||||
cDNA_position | 812 | ||||||||
CDS_position | 384 | ||||||||
Protein_position | 128 | ||||||||
Exon_number | 6/19 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F11A1.3e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3e.1:c.384G>A | ||||||||
HGVSp | CE54230:p.Trp128Ter | ||||||||
cDNA_position | 592 | ||||||||
CDS_position | 384 | ||||||||
Protein_position | 128 | ||||||||
Exon_number | 7/20 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F11A1.3e.4 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3e.4:c.384G>A | ||||||||
HGVSp | CE54230:p.Trp128Ter | ||||||||
cDNA_position | 545 | ||||||||
CDS_position | 384 | ||||||||
Protein_position | 128 | ||||||||
Exon_number | 6/19 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F11A1.3f.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3f.1:c.459G>A | ||||||||
HGVSp | CE54221:p.Trp153Ter | ||||||||
cDNA_position | 600 | ||||||||
CDS_position | 459 | ||||||||
Protein_position | 153 | ||||||||
Exon_number | 6/18 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F11A1.3a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3a.1:c.561G>A | ||||||||
HGVSp | CE27584:p.Trp187Ter | ||||||||
cDNA_position | 561 | ||||||||
CDS_position | 561 | ||||||||
Protein_position | 187 | ||||||||
Exon_number | 6/18 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F11A1.3g.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3g.1:c.561G>A | ||||||||
HGVSp | CE54229:p.Trp187Ter | ||||||||
cDNA_position | 592 | ||||||||
CDS_position | 561 | ||||||||
Protein_position | 187 | ||||||||
Exon_number | 7/19 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F11A1.3e.3 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3e.3:c.384G>A | ||||||||
HGVSp | CE54230:p.Trp128Ter | ||||||||
cDNA_position | 770 | ||||||||
CDS_position | 384 | ||||||||
Protein_position | 128 | ||||||||
Exon_number | 8/21 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F11A1.3d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11A1.3d.1:c.459G>A | ||||||||
HGVSp | CE39240:p.Trp153Ter | ||||||||
cDNA_position | 459 | ||||||||
CDS_position | 459 | ||||||||
Protein_position | 153 | ||||||||
Exon_number | 5/16 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor (59) | |||||||||
Genetics | Interpolated_map_position | X | 2.36893 | ||||||
Mapping_data | In_2_point | 432 | |||||||
In_multi_point (5) | |||||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00000504 | |||||
WBPaper00002149 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | defective dauer formation | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000093 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lineage defects | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00032266 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In 37% of daf-12(m20) mutants ray neuron axons showed guidance defects while following commissures to the pre-anal ganglion (data not shown). | Paper_evidence | WBPaper00032266 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006971 | PATO:0000460 | Paper_evidence | WBPaper00032266 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00032266 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000594 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | cell migration defects | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001085 | Paper_evidence | WBPaper00004310 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals exhibit severely reduced responses to butanone | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00005086 | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00002149 | |||||||
WBPaper00050052 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson5092 | |||||||||
Remark | Mean life span slightly shorter than N2 under same conditions. In control experiments, the life spans were nearly like that of wild type at 15. | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002149 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were raised at 15C and placed at 25.5C as L4 larvae or young adults for the life span assay. | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25.5C | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating always successful (ME3) at the permissive temperature, mating never successful (ME0) at 25C. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001983 | Paper_evidence | WBPaper00032266 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A high rate of leaving was obtained when the entire DIN-1 binding domain was deleted but the DBD remained intact. Hermaphrodites remained on food like wild-type hermaphrodites. | Unlike wild-type males, the leaving rate of daf-12(m20) males was not decreased by ablation of the gonad. | Paper_evidence | WBPaper00032266 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00032266 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All these animals retained a similar number of eggs when compared to wild-type animals (~10 eggs). | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Young well-fed animals were scored | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00032082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not exhibit reduced pharyngeal pumping when compared with daf-7(e1375). | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Pumping rates were assayed for well-fed , pheromone-untreated; food-deprived, pheromone-untreated; and well-fed, pheromone-treated animals. Pheromone treatment consisted of transfer of animals grown under well-fed conditions to plates containing 30 ul/ml of a dauer-pheromone prep (Golden and Riddle, 1982) and 30 ml of OP50 E. coli food. | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00005086 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00005086 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000147 | Paper_evidence | WBPaper00032266 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | After a period of food deprivation, the leaving rate of daf-12(m20) males was decreased in a manner similar to wild type. | Paper_evidence | WBPaper00032266 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00032266 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002149 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C, 25C | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Paper_evidence | WBPaper00032266 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous males were fully retained by hermaphroditesfor all daf-12 alleles tested. | Paper_evidence | WBPaper00032266 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00032266 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00032082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Fat levels were similar to that seen in wild-type but are reduced when compared to daf-7(e1375) as determined by Sudan Black assay (described in Kimura et al., 1997). | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | To minimize staining variability, which allowed for quantitative comparisons between various genotypes: animals from one genotype were labeled with fluorescein isothiocyanate (FITC) and then fixed and stained in the same tube as unlabeled animals from another genotype. | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 22 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001690 | Paper_evidence | WBPaper00002589 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were positive for mAb M37 at the L1 stage but not at any other stage, similar to N2 animals. | Paper_evidence | WBPaper00002589 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00002589 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 27.5 | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001692 | Paper_evidence | WBPaper00002589 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were induced by pheromone to display the L2 M37 epitope to the same extent as wildtype e.g. animals exhibit ILD. | Paper_evidence | WBPaper00002589 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001733 | Paper_evidence | WBPaper00032082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The pumping rate of food-deprived, pheromone-untreated young-adult animals alone was reduced to the same basal level as wild-type; in addition, the pumping-rate of well-fed, pheromone-treated animals was suppressed as observed for wild-type. | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Pumping rates were assayed for well-fed , pheromone-untreated; food-deprived, pheromone-untreated; and well-fed, pheromone-treated animals. Acute pheromone treatment consisted of the transfer of animals grown under well-fed conditions to plates containing 30 ul/ml of a dauer-pheromone prep (Golden and Riddle, 1982) and 30 ml of OP50 E. coli food. | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (19) | |||||||||
Method | Substitution_allele |