WormBase Tree Display for Variation: WBVar00143951
expand all nodes | collapse all nodes | view schema
WBVar00143951 | Evidence | Paper_evidence | WBPaper00004623 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1372 | |||||||
Other_name | B0412.2.1:c.369+1G>A | ||||||||
HGVSg | CHROMOSOME_III:g.812434G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0412 | |||||
Flanking_sequences | aatgatttggaaagaagcgatattcttcag | tatcgtttggtttttttttaaaaagaatcc | |||||||
Mapping_target | B0412 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004623 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000063 | ||||||||
WBStrain00004310 | |||||||||
WBStrain00005597 | |||||||||
WBStrain00006202 | |||||||||
WBStrain00006360 | |||||||||
WBStrain00022755 | |||||||||
WBStrain00023548 | |||||||||
WBStrain00026329 | |||||||||
WBStrain00026330 | |||||||||
WBStrain00026331 | |||||||||
WBStrain00035147 | |||||||||
WBStrain00035150 | |||||||||
WBStrain00050822 | |||||||||
WBStrain00050823 | |||||||||
WBStrain00050824 | |||||||||
WBStrain00050825 | |||||||||
WBStrain00050852 | |||||||||
WBStrain00051573 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000903 | |||||||
Transcript | B0412.2.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0412.2.1:c.369+1G>A | ||||||||
Intron_number | 3/6 | ||||||||
Interactor (86) | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00004623 | |||||
Genetics | Interpolated_map_position | III | -25.7993 | ||||||
Mapping_data | In_2_point | 273 | |||||||
422 | |||||||||
423 | |||||||||
2720 | |||||||||
2721 | |||||||||
4974 | |||||||||
6130 | |||||||||
In_multi_point (25) | |||||||||
In_pos_neg_data | 1585 | ||||||||
1592 | |||||||||
Description | Phenotype (34) | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00031688 | ||||||
WBPaper00038374 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | "In our hands, mutations in the upstream components of the TGF-b pathway such as daf-7 and daf-14 enhance dauer formation but do not significantly extend lifespan (Table S1 and Figure S4)." | Paper_evidence | WBPaper00038374 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00038374 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00001837 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Lifespans of adults were not noticeable different from wild type. Lifespans were examined when grown continuously at 15 deg C, or when shifted from 15 to 20 deg C and from 15 to 25 deg C as L4 animals. | Paper_evidence | WBPaper00001837 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00031997 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lag-2::GFP was expressed at the same levels as in dauer larvae induced by dauer pheromone, starvation or by Daf-c mutations in the three parallel pathways. There was no detectable changes in expression level between newly induced or older dauers. | Paper_evidence | WBPaper00031997 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005118 | PATO:0000460 | Paper_evidence | WBPaper00031997 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00031997 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | qIs56 [lag-2::GFP , unc-119(+)] | Paper_evidence | WBPaper00031997 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00036280 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Life span was lengthened in response to trehalose, similar to N2 animals under the same conditions. | Paper_evidence | WBPaper00036280 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000671 | Paper_evidence | WBPaper00004599 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | daf-7(e1372) mutant animals were not resistant to copper (Figure 1A) | Paper_evidence | WBPaper00004599 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00004599 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00035610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | daf-3 transcripts were not affected in daf-7 mutants | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | qRT-PCR | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00034730 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants had normal sensitivity to cholinergic agonists | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001068 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | 5 mg/ml serotonin | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00053184 | |||||||
Curator_confirmed | WBPerson12433 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00053184 | |||||||
Curator_confirmed | WBPerson12433 | ||||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001573 | Paper_evidence | WBPaper00034730 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants had normal sensitivity to cholinergic agonists | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001999 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The integration of signals for attraction to diacetyl (100x dilute) and avoidance from copper (100 millimolar) was normal (like wild type) in daf-7(e1372) mutants, resulting in the same number of animals crossing the copper barrier to get to the diacetyl spot compared to wild type controls (Figure 5) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (65) | |||||||||
Method | Substitution_allele |