WormBase Tree Display for Variation: WBVar00249122
expand all nodes | collapse all nodes | view schema
WBVar00249122 | Evidence | Paper_evidence | WBPaper00003574 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | t1512 | |||||||
Other_name (12) | |||||||||
HGVSg | CHROMOSOME_III:g.13722275T>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | W06F12 | |||||
Flanking_sequences | aatatttccaattttgcaggactaaaatatt | gcacactgcaaacatcctgcatcgagacatc | |||||||
Mapping_target | W06F12 | ||||||||
Type_of_mutation | Substitution | t | c | Paper_evidence | WBPaper00003574 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007762 | ||||||||
WBStrain00008483 | |||||||||
Laboratory | GE | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003048 | |||||||
Transcript | W06F12.1a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W06F12.1a.1:c.1070T>C | ||||||||
HGVSp | CE29476:p.Leu357Ser | ||||||||
cDNA_position | 1070 | ||||||||
CDS_position | 1070 | ||||||||
Protein_position | 357 | ||||||||
Exon_number | 9/11 | ||||||||
Codon_change | tTg/tCg | ||||||||
Amino_acid_change | L/S | ||||||||
W06F12.1c.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W06F12.1c.1:c.479T>C | ||||||||
HGVSp | CE29478:p.Leu160Ser | ||||||||
cDNA_position | 747 | ||||||||
CDS_position | 479 | ||||||||
Protein_position | 160 | ||||||||
Exon_number | 6/8 | ||||||||
Codon_change | tTg/tCg | ||||||||
Amino_acid_change | L/S | ||||||||
W06F12.1b.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W06F12.1b.1:c.554T>C | ||||||||
HGVSp | CE29477:p.Leu185Ser | ||||||||
cDNA_position | 601 | ||||||||
CDS_position | 554 | ||||||||
Protein_position | 185 | ||||||||
Exon_number | 7/9 | ||||||||
Codon_change | tTg/tCg | ||||||||
Amino_acid_change | L/S | ||||||||
W06F12.1e.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W06F12.1e.1:c.530T>C | ||||||||
HGVSp | CE37161:p.Leu177Ser | ||||||||
cDNA_position | 530 | ||||||||
CDS_position | 530 | ||||||||
Protein_position | 177 | ||||||||
Exon_number | 5/6 | ||||||||
Codon_change | tTg/tCg | ||||||||
Amino_acid_change | L/S | ||||||||
W06F12.1d.2 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W06F12.1d.2:c.971T>C | ||||||||
HGVSp | CE37160:p.Leu324Ser | ||||||||
cDNA_position | 1057 | ||||||||
CDS_position | 971 | ||||||||
Protein_position | 324 | ||||||||
Exon_number | 11/13 | ||||||||
Codon_change | tTg/tCg | ||||||||
Amino_acid_change | L/S | ||||||||
W06F12.1d.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W06F12.1d.1:c.971T>C | ||||||||
HGVSp | CE37160:p.Leu324Ser | ||||||||
cDNA_position | 1095 | ||||||||
CDS_position | 971 | ||||||||
Protein_position | 324 | ||||||||
Exon_number | 11/13 | ||||||||
Codon_change | tTg/tCg | ||||||||
Amino_acid_change | L/S | ||||||||
W06F12.1d.3 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W06F12.1d.3:c.971T>C | ||||||||
HGVSp | CE37160:p.Leu324Ser | ||||||||
cDNA_position | 1022 | ||||||||
CDS_position | 971 | ||||||||
Protein_position | 324 | ||||||||
Exon_number | 10/12 | ||||||||
Codon_change | tTg/tCg | ||||||||
Amino_acid_change | L/S | ||||||||
Interactor (20) | |||||||||
Genetics | Interpolated_map_position | III | 21.4033 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | At 25C, some lit-1 homozygotes (derived from lit-1/+ mothers) are Egl | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | unc-32(e189) | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00037107 | |||||||
Curator_confirmed | WBPerson503 | ||||||||
WBPhenotype:0000052 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | 100 percent Mel at 20C | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20C, 25C | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | unc-32(e189) | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000097 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The AB blastomere produces only 2 instead of 7 specific pharyngeal cells. Also AB blastomere generates only 6 of 20 hypodermal seam cells | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | AB blastomeres are isolated via laser ablation, followed by staining with 3NB12. lit-1 mutants were stained with NE2-1B14 (seam cell) antibodies | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 25C | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000104 | Paper_evidence | WBPaper00003570 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Less than 50% of animals exhibit altered T cell division polarity, in all of these cases, daughter cells exhibit symmetric cell division. | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00003570 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The E-lineage in t1512 mutants adopts an MS-like fate | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000472 | Paper_evidence | WBPaper00003570 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No animals lack endoderm at 15 deg C. This phenotype is only partially rescued by [LIT-1::GFP]. | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00003570 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | At 25C, some lit-1 homozygotes (derived from lit-1/+ mothers) are sterile | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | unc-32(e189) | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000832 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In the C-lineage, Cap descendants adopt the same fate pattern as the anterior Caa descendants (hypodermal fate at the expense of body-wall muscle) | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000834 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The E-lineage in t1512 mutants execute an MS-like lineage pattern | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000933 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Anterior sublineages are not only expressed in their normal positions but also in more posterior positions. For example, MSap and MSpp adopt the same fates as MSaa and MSpa respectively | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001225 | Paper_evidence | WBPaper00004350 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 18 | Paper_evidence | WBPaper00004350 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001408 | Paper_evidence | WBPaper00003570 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Sister cells resulting from AP divisions expressed similar levels of POP-1 protein as opposed to asymmetric levels as observed for control animals. | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001597 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | MS produces only 3 instead of 28 body-wall muscle cells. Body-wall muscle cells are also significantly reduced from 32 to 9 in the C-blastomere | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Target blastomeres (such as C and EMS) are isolated via laser ablation, followed by staining with NE8 4C6.3 antibody | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 25C | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001635 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Embryos have an excess of MS-like pharyngeal cells that are derived from E blastomere. Also MS blastomere generates 10 extra pharyngeal cells | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Target blastomeres (such as E or MS) are isolated via laser ablation, followed by staining with 3NB12 antibody | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 25C | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001637 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Embryos completely lack E-blastomere derived intestinal cells | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with ICB4 antibody | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 25C | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001968 | Paper_evidence | WBPaper00005116 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 4 | Paper_evidence | WBPaper00005116 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000155 | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% of animals exhibited reversed T cell division polarity. | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00003570 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00037107 | ||||||||
WBPaper00004350 | |||||||||
WBPaper00003570 | |||||||||
WBPaper00005116 | |||||||||
WBPaper00002946 | |||||||||
WBPaper00023727 | |||||||||
WBPaper00018985 | |||||||||
Method | Substitution_allele |