WormBase Tree Display for Variation: WBVar00248909
expand all nodes | collapse all nodes | view schema
WBVar00248909 | Evidence | Person_evidence | WBPerson625 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy97 | |||||||
Other_name | ZK1067.1a.1:c.3803-1G>T | ||||||||
ZK1067.1b.1:c.3620-1G>T | |||||||||
ZK1067.1c.1:c.3818-1G>T | |||||||||
ZK1067.1d.1:c.3839-1G>T | |||||||||
HGVSg | CHROMOSOME_II:g.9206768G>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | |||||
Flanking_sequences | ttttcacccaacgcattaaaaaagttacttttaaaataataaattttca | agctatccccatcaaatggcgattactacaaccaaccaaacactccttca | |||||||
Mapping_target | ZK1067 | ||||||||
Type_of_mutation | Substitution | a | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022495 | ||||||||
WBStrain00030810 | |||||||||
WBStrain00030821 | |||||||||
Laboratory | PS | ||||||||
Author | Aroian R | ||||||||
Sternberg P | |||||||||
Person | WBPerson625 | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002299 | |||||||
Transcript | ZK1067.1d.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1d.1:c.3839-1G>T | ||||||||
Intron_number | 19/20 | ||||||||
ZK1067.1b.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1b.1:c.3620-1G>T | ||||||||
Intron_number | 15/15 | ||||||||
ZK1067.1c.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1c.1:c.3818-1G>T | ||||||||
Intron_number | 17/18 | ||||||||
ZK1067.1a.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1a.1:c.3803-1G>T | ||||||||
Intron_number | 18/19 | ||||||||
Interactor | WBInteraction000000671 | ||||||||
WBInteraction000500653 | |||||||||
WBInteraction000504224 | |||||||||
WBInteraction000524138 | |||||||||
WBInteraction000524142 | |||||||||
WBInteraction000538578 | |||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | standard phenotypic screen | ||||||||
Genetics | Interpolated_map_position | II | 1.09465 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001404 | |||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson1845 | ||||||||
WBPerson712 | |||||||||
Remark | Egg laying defect is a consequence of Vul phenotype. | Person_evidence | WBPerson625 | ||||||
Curator_confirmed | WBPerson1845 | ||||||||
Displays intragenic complementation with sy1 for this phenotype, i.e., 53% of sy1/sy97 animals are not Egl. | Paper_evidence | WBPaper00001404 | |||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Person_evidence | WBPerson625 | ||||||
Curator_confirmed | WBPerson1845 | ||||||||
Complete | Paper_evidence | WBPaper00001404 | |||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson1845 | ||||||||
WBPerson712 | |||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
WBPhenotype:0000054 | Person_evidence | WBPerson625 | |||||||
Curator_confirmed | WBPerson1845 | ||||||||
Penetrance | Incomplete | Person_evidence | WBPerson625 | ||||||
Curator_confirmed | WBPerson1845 | ||||||||
Recessive | Person_evidence | WBPerson625 | |||||||
Curator_confirmed | WBPerson1845 | ||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00001404 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 10% viable | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
High | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000070 | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male tails displayed various defects. | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000216 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | defect in Bγ cell fate specification | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0001708 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000296 | Paper_evidence | WBPaper00001404 | |||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson1845 | ||||||||
WBPerson712 | |||||||||
Remark | Spicules varied from slightly shortened and broken to severely crumpled and disorganized. | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Person_evidence | WBPerson625 | ||||||
Curator_confirmed | WBPerson1845 | ||||||||
Complete | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson1845 | ||||||||
WBPerson712 | |||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00001404 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00001404 | |||||||
WBPaper00003135 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Animals have 95% wild-type P12 as homozygotes. Animals exhibit more P12-P11 cell transformations when in trans to sy12. The effects of this mutation can be significantly alleviated by maternal gene activity. | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
let-23(sy97) resulted in a 44% penetrant P12 to P11 cell fate transformation (Table 1A) | Paper_evidence | WBPaper00003135 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 44% penetrance | Paper_evidence | WBPaper00003135 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00001404 | ||||
WBPaper00003135 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
WBbt:0004410 | PATO:0000460 | Paper_evidence | WBPaper00003135 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000443 | Paper_evidence | WBPaper00001404 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Spicules varied from slightly shortened and broken to severely crumpled and disorganized. | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
abnormal spicules | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00001404 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | 95% hermaphrodites are fertile (n=22). | Paper_evidence | WBPaper00001404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000692 | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous males do not produce cross progeny. | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00002375 | |||||||
WBPaper00001404 | |||||||||
Person_evidence | WBPerson625 | ||||||||
WBPerson261 | |||||||||
Curator_confirmed | WBPerson1845 | ||||||||
WBPerson712 | |||||||||
Remark | Phenotype is not suppressed by sy322. | Paper_evidence | WBPaper00002375 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Vul | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Person_evidence | WBPerson625 | ||||||
Curator_confirmed | WBPerson1845 | ||||||||
Complete | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||||
Person_evidence | WBPerson625 | ||||||||
Curator_confirmed | WBPerson1845 | ||||||||
WBPerson712 | |||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
WBPhenotype:0000859 | Paper_evidence | WBPaper00045995 | |||||||
Curator_confirmed | WBPerson43879 | ||||||||
Remark | Figure 4. G1 delamination defect | Paper_evidence | WBPaper00045995 | ||||||
Curator_confirmed | WBPerson43879 | ||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00045995 | |||||
Curator_confirmed | WBPerson43879 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | decreased sIys145 expression in Bγ | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0010467 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Reference (27) | |||||||||
Remark | Isolated in 1987 as a suppressor of the lin-15(n309) multivulva phenotype | Person_evidence | WBPerson26 | ||||||
alt_det = affects splide acceptor and causes a missolice two nt 3'; thus a frameshift that replaces C-terminal 56 amino acids with 23 novel amino acids mut_det = ag --> aa at splice acceptor of exon 18 | |||||||||
Method | Substitution_allele |