WormBase Tree Display for Variation: WBVar00248908
expand all nodes | collapse all nodes | view schema
WBVar00248908 | Evidence | Paper_evidence | WBPaper00001756 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy96 | |||||||
Other_name | Y73B6A.5e.1:c.589-1G>A | ||||||||
Y73B6A.5b.1:c.811-1G>A | |||||||||
Y73B6A.5f.1:c.553-1G>A | |||||||||
Y73B6A.5c.1:c.640-1G>A | |||||||||
Y73B6A.5d.1:c.760-1G>A | |||||||||
Y73B6A.5a.1:c.685-1G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.6746097C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y73B6A | |||||
Flanking_sequences | acaattcttatctaaaacatttaattttca | ctagtgaaagaactctttgggatcgcatca | |||||||
Mapping_target | Y73B6A | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001756 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027280 | ||||||||
WBStrain00030711 | |||||||||
WBStrain00030713 | |||||||||
WBStrain00030718 | |||||||||
WBStrain00030812 | |||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003030 | |||||||
Transcript (6) | |||||||||
Interactor | WBInteraction000519051 | ||||||||
WBInteraction000535559 | |||||||||
WBInteraction000563586 | |||||||||
WBInteraction000563587 | |||||||||
WBInteraction000563588 | |||||||||
Genetics | Interpolated_map_position | IV | 3.22834 | ||||||
Mapping_data | In_multi_point | 1641 | |||||||
1642 | |||||||||
1929 | |||||||||
3152 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001724 | |||||
Curator_confirmed | WBPerson237 | ||||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00001724 | |||||||
Curator_confirmed | WBPerson237 | ||||||||
WBPhenotype:0000411 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | subviable, >90% die as rod-like L1, escapers mostly Egl, Vul; suppresses lin-15Muv; impenetrant P12 to P11 transformation; partial maternal rescue of larval lethality. Effects on male development resemble F and U ablation | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Escapers mostly Egl, Vul; suppresses lin-15Muv; impenetrant P12 to P11 transformation; partial maternal rescue of larval lethality. Effects on male development resemble F and U ablation | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000651 | Paper_evidence | WBPaper00024311 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals become severely constipated compared to wild-type worms when grown on lawns of M. nematophilum, whereas they are not constipated when grown on standard E. coli food source, OP50. | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown on NGM plates seeded with trace (usually 0.01% (v/v)) M. nematophilum in OP50. Strains were cultured on these plates at 25*C. | Paper_evidence | WBPaper00024311 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00001724 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson237 | |||||||||
Remark | Escapers mostly Vul;; impenetrant P12 to P11 transformation; partial maternal rescue of larval lethality. Effects on male development resemble F and U ablation | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00024311 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The severety of constipation induced in animals grown in the presence of M. nematophilum suggests these animals are hypersensitive to infection by this pathogen. | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown on NGM plates seeded with trace (usually 0.01% (v/v)) M. nematophilum in OP50. Strains were cultured on these plates at 25*C. | Paper_evidence | WBPaper00024311 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001060 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005086 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00002087 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004538 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001061 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004538 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001413 | Paper_evidence | WBPaper00024311 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals failed to swell when exposed to Microbacterium nematophilum, although bacteria were present in the rectum of these animals. Bacteria were visualized by nucleic acid dye SYTO 13. | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown on NGM plates seeded with trace (usually 0.01% (v/v)) M. nematophilum in OP50. Strains were cultured on these plates at 25*C. | Paper_evidence | WBPaper00024311 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00005245 | |||||||
WBPaper00006119 | |||||||||
WBPaper00029116 | |||||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Mutation blocks muscle protein degradation increase in let-60(ga89) animals | Paper_evidence | WBPaper00005245 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Blocks muscle protein degradation induced by clr-1(e1745) | Paper_evidence | WBPaper00006119 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Blocks protein degradation in response to treatment with the AGE-1 inhibitor LY-294002 | Paper_evidence | WBPaper00029116 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Affected_by | Molecule | WBMol:00005384 | Paper_evidence | WBPaper00029116 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_assay | Genotype | let-60(ga89) | Paper_evidence | WBPaper00005245 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
clr-1(e1745) | Paper_evidence | WBPaper00006119 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_not_observed | WBPhenotype:0001084 | Paper_evidence | WBPaper00003955 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002193 | Paper_evidence | WBPaper00044058 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "No allele of egl-17, egl-15 or any other downstream FGF component other than sem-5 had any effect on orientation as single mutants (Table 1), which is probably due to the involvement of sem-5 in one of the other pathways controlling vulval orientation as well as its role in the FGF pathway." | Paper_evidence | WBPaper00044058 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00044058 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002378 | Paper_evidence | WBPaper00054670 | |||||||
Curator_confirmed | WBPerson2706 | ||||||||
Remark | animals avoid OP50 lawns contaminated with Microbacterium nematophilum as wild type | Paper_evidence | WBPaper00054670 | ||||||
Curator_confirmed | WBPerson2706 | ||||||||
Reference (20) | |||||||||
Method | Substitution_allele |