WormBase Tree Display for Variation: WBVar00145224
expand all nodes | collapse all nodes | view schema
WBVar00145224 | Name | Public_name | ev400 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE04538:p.Gln99Ter | ||||||||
F41C6.1.1:c.295C>T | |||||||||
F41C6.1.2:c.295C>T | |||||||||
HGVSg | CHROMOSOME_X:g.6890534C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F41C6 | |||||
Flanking_sequences | tgtgacacttgtgatgctagaaaccatttc | aatcccatccagcctctcttctaactgatc | |||||||
Mapping_target | F41C6 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002378 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (69) | |||||||||
Laboratory | NW | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006746 | |||||||
Transcript | F41C6.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F41C6.1.1:c.295C>T | ||||||||
HGVSp | CE04538:p.Gln99Ter | ||||||||
cDNA_position | 361 | ||||||||
CDS_position | 295 | ||||||||
Protein_position | 99 | ||||||||
Exon_number | 4/15 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F41C6.1.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F41C6.1.2:c.295C>T | ||||||||
HGVSp | CE04538:p.Gln99Ter | ||||||||
cDNA_position | 361 | ||||||||
CDS_position | 295 | ||||||||
Protein_position | 99 | ||||||||
Exon_number | 4/16 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (31) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | X | -2.1004 | ||||||
Mapping_data | In_multi_point | 4795 | |||||||
Description | Phenotype | WBPhenotype:0000104 | Paper_evidence | WBPaper00035117 | |||||
WBPaper00035146 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The polarity of the dense F-actin network was perturbed in unc-6(ev400) mutants. INA-1/PAT-3::GFP was localized normally in unc-6(ev400) | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
UNC-40::GFP is not asymmetrically localized like WT but is more equally distributed across the HSN surface. | Paper_evidence | WBPaper00035146 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000181 | Paper_evidence | WBPaper00031671 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | 32% of the NSM neurons have no dorsal process and 24% have a short dorsal process in unc-6 mutants | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "An additional double mutant was constructed between unc-52(ev620) and unc-6(ev400), and in this case also, the penetrance of defects was greater than in unc-6(ev400) alone (Table 1). unc-6(ev400) alone exhibited 48% anterior and 83% posterior DTC defects (n = 122). The double mutant unc-52(ev620); unc-6(ev400) exhibited 79% anterior (P < 0.001) and 91% posterior (P < 0.05) DTC defects (n = 100)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000299 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | high frequency of phasmid axon displacement | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006753 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000352 | Paper_evidence | WBPaper00033081 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Strong Unc phenotype | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00031901 | |||||||
WBPaper00032163 | |||||||||
WBPaper00036484 | |||||||||
WBPaper00035146 | |||||||||
WBPaper00040147 | |||||||||
WBPaper00031828 | |||||||||
WBPaper00040041 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 714 HSN neurons fail to reach the VNC whereas 203 neurons exhibit mild defects (n=150). | Paper_evidence | WBPaper00031901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Half of animals exhibited DA9 axon guidance defects. | Paper_evidence | WBPaper00032163 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
The primary axon of ADL grows into the nerve ring ventrally rather than laterally. This phenotype occurs at a lower frequency than the axon branching phenotype. AVM axons fail to grow ventrally. HSN motor neurons fail to polarize properly. | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
AVM axons migrate anteriorly and HSN axons migrate in a number of aberrant patterns. | Paper_evidence | WBPaper00035146 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Mutants displayed a nearly complete failure of dorsally directed VD axons to reach the dorsal cord. | Paper_evidence | WBPaper00040147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals had strong axon guidance defects. | Paper_evidence | WBPaper00040147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals exhibit dorsal guidance defects. | Paper_evidence | WBPaper00031828 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals exhibit AVM ventral axon guidance defects. These defects can be rescued by exogenous acetylcholine. | Paper_evidence | WBPaper00040041 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
High | Paper_evidence | WBPaper00031901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004765 | Paper_evidence | WBPaper00040041 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term (7) | ||||||||
Phenotype_assay | Treatment | 25 | Paper_evidence | WBPaper00032163 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | unc-5::intron::unc-5 | Paper_evidence | WBPaper00032163 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Loss of UNC-6 resulted in the mislocalization of UNC-40::GFP along lateral and apical membranes. Polarized localization of MIG-2, F-actin, PtdIns (4,5) P2 and UNC-34 was dependent on UNC-6. In unc-6 mutants, there was a 65% reduction in HIM-4 deposited under the invasive cell membrane and a threefold increase in HIM-4 accumulation along lateral and apical membranes of the AC, compared with wild-type controls | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | qyIs66 and qyIs67 [cdh-3p::UNC-40::GFP], muIs27[GFP::mig-2], qyIs61[cdh-3::GFP::unc-34], qyIs23[cdh-3::mCherry:: PLCPH], qyIs24[cdh-3::mCherry::PLCPH], qyIs50[cdh-3::mCherry::moeABD], syIs129[hemicentin-SP::GFP] | Paper_evidence | WBPaper00032446 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000511 | Paper_evidence | WBPaper00040080 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Although the DTCs were always directed dorsally at the first turn in the wild type, they turned dorsally or ventrally as well as laterally in unc-6 mutants. When we examined the unc-6 DTCs after the first turn, the nuclei were always translocated to the leading edge of the DTCs irrespective of the turning direction. | Paper_evidence | WBPaper00040080 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00040147 | |||||||
WBPaper00045955 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson557 | |||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Anatomy_term (2) | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00038105 | |||||||
WBPaper00040335 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson7190 | |||||||||
Remark | More Unc than e78. | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
uncoordinated, high frequency of phasmid axon displacement | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
animals are severely uncoordinated in movement | Paper_evidence | WBPaper00040335 | |||||||
Curator_confirmed | WBPerson7190 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00035146 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | UNC-40::GFP is globally localized unlike in wild type animals, and in HSN is evenly distributed along the surface rather than asymmetrically localized. | Paper_evidence | WBPaper00035146 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00033081 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Highly penetrant vulval morphology defect: vulF is misshapen | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00032163 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Presynaptic components, such as RAB-3, SNB-1/synaptobrevin and SNG-1/synaptogyrin, the L-type voltage gated calcium channel b-subunit CCB-1, and the active zone protein SYD-2/a-liprin were mislocalized to the dendrite. | Paper_evidence | WBPaper00032163 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004857 | PATO:0000460 | Paper_evidence | WBPaper00032163 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000880 | Paper_evidence | WBPaper00056066 | |||||||
Curator_confirmed | WBPerson18979 | ||||||||
Remark | ALA axon mispositioned | Paper_evidence | WBPaper00056066 | ||||||
Curator_confirmed | WBPerson18979 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00056066 | ||||
Curator_confirmed | WBPerson18979 | ||||||||
GO_term | GO:0030424 | PATO:0000628 | Paper_evidence | WBPaper00056066 | |||||
Curator_confirmed | WBPerson18979 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00032163 | |||||||
WBPaper00056066 | |||||||||
WBPaper00056964 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson18979 | |||||||||
WBPerson48777 | |||||||||
Remark | The localization of four dendritically localized proteins (CAM-1/ROR16, UNC-9/innexin, F35D2.3/fibrillin and DYS-1/dystrophin16) were unaffected. | Paper_evidence | WBPaper00032163 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
PVD 1° dendrite branch mispositioned | Paper_evidence | WBPaper00056066 | |||||||
Curator_confirmed | WBPerson18979 | ||||||||
3° dendrites that fail to self-avoid and overgrow one another. Fig 3D | Paper_evidence | WBPaper00056964 | |||||||
Curator_confirmed | WBPerson48777 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
EQ_annotations | Anatomy_term (2) | ||||||||
GO_term | GO:0044307 | PATO:0000628 | Paper_evidence | WBPaper00056066 | |||||
Curator_confirmed | WBPerson18979 | ||||||||
Phenotype_assay | Control_strain | WBStrain00047813 | Paper_evidence | WBPaper00056964 | |||||
Curator_confirmed | WBPerson48777 | ||||||||
Genotype | wdIs52 (pF49H12.4::GFP) | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00004481 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To determine whether a proximity of the AC and the 1° VPC descendants is required for 1° lineage patterning, we examined dig-1 or unc-6 mutants, with or without AC attachment... In unc-6 mutants, the gonad is positioned ventrally as in wild type. However, in about 22% of the animals, the AC improperly migrates dorsally or laterally within the ventral gonad (the distance between the AC and P6.pxx cells is less than 20 μm), rather than attaching to the inner P6.pxx cells during L3 lethargus (Hedgecock et al., 1990; D. R. Sherwood and P. W. S., unpublished). In 26 animals with a displaced AC, only four of 26 P6.p cells had wild-type patterns of zmp-1::GFP expression in its progeny (Table 2). In contrast, when the AC was correctly positioned and attached to inner P6.pxx cells, all 37 P6.p cells formed the wild-type 1° pattern, indicating that the P6.p descendants are capable of forming a wild-type 1° pattern in an unc-6 background, when the AC is correctly positioned (P<0.0001, Table 2)." | Paper_evidence | WBPaper00004481 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00004481 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | syIs49 [zmp-1::GFP] | Paper_evidence | WBPaper00004481 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00038105 | |||||||
WBPaper00003665 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit less axon outgrowth defects than e78. | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
71% of animals showed wild-type ASI amphid neuron outgrowth. Mutants also showed premature axon termination (12%) or lateral axon outgrowth (17%). | Paper_evidence | WBPaper00003665 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003665 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00003665 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kyIs128[str-3::GFP] | Paper_evidence | WBPaper00003665 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001227 | Paper_evidence | WBPaper00027335 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Ray commissures absent: R1, R2/3, R4/5. | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Range | 72 | 88 | Paper_evidence | WBPaper00027335 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
WBPaper00033081 | |||||||||
WBPaper00039950 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | AC failed to invade in unc-6(ev400) mutants and only partially completed a delayed invasion by the L4 stage | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variable AC invasion defects: 38% of animals show no AC invasion and 44% of animals show an obvious interruption in the basement membrane but no significant vulF penetration by the AC | Paper_evidence | WBPaper00033081 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | kuIs38 [cdh-3::GFP] | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001798 | Paper_evidence | WBPaper00032163 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001801 | Paper_evidence | WBPaper00032163 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Presynaptic components such as RAB-3, calcium channel subunits and other active zone proteins are not excluded from DA9 dendrites as they are in control animals. | Paper_evidence | WBPaper00032163 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004857 | PATO:0000460 | Paper_evidence | WBPaper00032163 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001931 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have 4-6 muscle arms per side that project into the lateral space as they extended towards misguided commissural motor axons. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001984 | Paper_evidence | WBPaper00038105 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a high level of long-range axon migration defects | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001985 | Paper_evidence | WBPaper00038105 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a low level of short-range axon migration defects. | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00033081 | ||||||
WBPaper00004437 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson2987 | |||||||||
Remark | Polarity is normal in all mutants | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
"Using MIG-2::GFP, we confirmed that Q cell polarization in unc-6 mutants was also normal (data not shown)." | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term (2) | ||||||||
GO_term | GO:0030010 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kuIs47 [AJM-1::GFP] | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
MIG-2::GFP | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000220 | Paper_evidence | WBPaper00033081 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | zmp-1 and lin-3 markers are expressed in the correct cell at the expected time in over 90% of the mutants | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | syIs107[lin-3(delta-pes-10)::GFP], syIs49[zmp- 1::GFP] | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00046107 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | From the text: "To examine whether the axonal distribution of UNC-6 by IRE-1 was required for UNC-6-mediated axon guidance, we generated worms in which UNC-6 was expressed only in the ventral neurons. We used the glr-1 promoter (Hart et al . 1995) to drive unc-6 gene expression in the ventral neurons in unc-6 null mutants. In these worms, UNC-6 was observed in the axons and cell bodies (Fig. 2D)." | Paper_evidence | WBPaper00046107 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Genotype | [ghEx15(glr-1p::unc-6::Venus; tph-1p::GFP)] | Paper_evidence | WBPaper00046107 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that in the null allele unc-6 (ev400) (Ishii et al., 1992), the Q cells still migrated almost as far as they do in wild type (Fig. 2)." | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term (2) | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00032446 | |||||||
WBPaper00036484 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | PAR-3::GFP, which localizes to apical and lateral membranes in wild-type ACs and AJM-1::GFP which marks nascent apical spot junctions, were normal in unc-6 mutants | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
MADD-2::GFP was excluded from the dorsal ADL branch and was present at high levels in the cell body, a pattern that was also observed in control animals. | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | zuIs20 [par-3::GFP] , jcIs1[ajm-1::GFP] | Paper_evidence | WBPaper00032446 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Transcriptional reporters for FOS-1A and two of its downstream targets, ZMP-1, a matrix metalloproteinase, and hemicentin (HIM-4), a conserved extracellular matrix protein, were expressed normally in unc-6 mutants | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | rhIs23[hemicentin::GFP], qyIs17[zmp-1p::mCherry], syIs77[zmp-1::YFP] | Paper_evidence | WBPaper00032446 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ventral muscle arm extension in animals was indistinguishable from that of wild-type controls. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (40) | |||||||||
Method | Substitution_allele |