WormBase Tree Display for Variation: WBVar00145005
expand all nodes | collapse all nodes | view schema
WBVar00145005 | Evidence | Paper_evidence | WBPaper00026735 | |||||
---|---|---|---|---|---|---|---|---|
WBPaper00028877 | ||||||||
Name | Public_name | e2800 | ||||||
Other_name | ZK678.8.1:c.952C>T | |||||||
CE40491:p.His318Tyr | ||||||||
HGVSg | CHROMOSOME_X:g.15758090G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK678 | ||||
Flanking_sequences | aagcactcatttgacgactttgttgtttat | attatcagtattcgaggcactcggcgaaat | ||||||
Mapping_target | ZK678 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004675 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00044630 | ||||||
Transcript | ZK678.8.1 (12) | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | X | 22.9588 | |||||
Description | Phenotype | WBPhenotype:0000010 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Complete | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000031 | Paper_evidence | WBPaper00037686 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited markedly slower larval growth than wild type. Generation time was ~15 hours longer than for wild type animals. | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00037686 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were notably smaller than wild type in mature adult body size. | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000586 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Complete | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00037686 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are able to crawl fairly efficiently across bands of CBX120 (Bacillus pumilus) bacteria growth (hurdles). By contrast, wild type worms move through these bands with great difficulty. | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001014 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Resistant to M. nematophilum. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Complete | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001209 | Paper_evidence | WBPaper00026735 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Complete | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001212 | Paper_evidence | WBPaper00026735 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Very strongly more fragile than wild type, based on a comparison of bleach sensitivity. | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001411 | Paper_evidence | WBPaper00026735 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
Remark (2) | ||||||||
Penetrance | Complete | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Treatment | Tested the following fluorescein or rhodamine-conjugated lectins: WGA, SBA, TPA, PEA,, CON, LEA. | Paper_evidence | WBPaper00026735 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001413 | Paper_evidence | WBPaper00026735 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001416 | Paper_evidence | WBPaper00026735 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Based on vital dye staining for bacteria to reveal M. nematophilum; no rectal staining, indicating no adherence in the usual region. | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001418 | Paper_evidence | WBPaper00026735 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001420 | Paper_evidence | WBPaper00031925 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are completely resistant to attachment of biofilm produced by Xenorhabdus nematophila. | Paper_evidence | WBPaper00031925 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00031925 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Biofilm formation on adult worms was assessed for worms incubated 24-48 hours on the bacterial lawn. Alternatively, gravid adults were allowed to lay eggs on bacterial lawns for several hours, then removed and larvae were assessed for biofilm attachment the next day. | Paper_evidence | WBPaper00031925 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001918 | Paper_evidence | WBPaper00052991 | ||||||
Curator_confirmed | WBPerson38714 | |||||||
WBPhenotype:0002159 | Paper_evidence | WBPaper00045395 | ||||||
Curator_confirmed | WBPerson499 | |||||||
WBPhenotype:0002354 | Paper_evidence | WBPaper00045395 | ||||||
Curator_confirmed | WBPerson499 | |||||||
WBPhenotype:0002462 | Paper_evidence | WBPaper00045395 | ||||||
Curator_confirmed | WBPerson499 | |||||||
Remark | increased fungal spore adhesion | Paper_evidence | WBPaper00045395 | |||||
Curator_confirmed | WBPerson499 | |||||||
WBPhenotype:0004006 | Paper_evidence | WBPaper00037686 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Hermaphrodites experienced significantly reduced contact times by males during mating. | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00026735 | |||||||
WBPaper00031925 | ||||||||
WBPaper00037686 | ||||||||
WBPaper00052991 | ||||||||
WBPaper00045395 | ||||||||
Method | Substitution_allele |