WormBase Tree Display for Variation: WBVar00144429
expand all nodes | collapse all nodes | view schema
WBVar00144429 | Evidence | Paper_evidence | WBPaper00004384 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1960 | |||||||
Other_name | F56H1.1.1:c.2601+1G>A | ||||||||
HGVSg | CHROMOSOME_I:g.5753561G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F56H1 | |||||
Flanking_sequences | ttaccagcgttgactcatgcgttctatcag | ttttttttttgaatattacatgtttccaaa | |||||||
Mapping_target | F56H1 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004500 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000493 | |||||||
Transcript | F56H1.1.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56H1.1.1:c.2601+1G>A | ||||||||
Intron_number | 18/19 | ||||||||
Genetics | Interpolated_map_position | I | 0.440705 | ||||||
Mapping_data | In_multi_point | 986 | |||||||
Description | Phenotype | WBPhenotype:0000257 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Some FITC uptake by amphids but not by phasmids; abnormal uptake by CEP ADE PDE; abnormal amphid channel due to misjoining of sheath and socket cell. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005425 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score (2) | ||||||||
WBPhenotype:0000299 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal uptake by CEP ADE PDE; abnormal amphid channel due to misjoining of sheath and socket cell | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005244 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005415 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006747 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005391 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of ray sensilla. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Intermediate response to dauer inducing conditions as assayed through SDS resistance of animals from a crowded, starved plate. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Intermediate response to concentrated NaCl. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency 3; 10-30% of WT mating efficiency. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Intermediate response to dilute NaCl gradient. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001528 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Socket and sheath channels are abnormal and frequently do not join properly. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005107 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | CEP frequently stains with FITC. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ADE and PDE frequently stains with FITC. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00055368 | |||||||
Curator_confirmed | WBPerson466 | ||||||||
Remark | survive 10nM ivermectin | Paper_evidence | WBPaper00055368 | ||||||
Curator_confirmed | WBPerson466 | ||||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00055368 | |||||
Curator_confirmed | WBPerson466 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Amphid neurons frequently fail to stain with FITC; however phasmid neurons rarely or never stain. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005391 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005425 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00000932 | ||||||||
WBPaper00029016 | |||||||||
WBPaper00001786 | |||||||||
WBPaper00011810 | |||||||||
WBPaper00011546 | |||||||||
WBPaper00023432 | |||||||||
WBPaper00055368 | |||||||||
WBPaper00064927 | |||||||||
Method | Substitution_allele |