WormBase Tree Display for Variation: WBVar00143874
expand all nodes | collapse all nodes | view schema
WBVar00143874 | Evidence | Paper_evidence | WBPaper00037788 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1265 | |||||||
Other_name | C52E12.2a.1:c.4489G>A | ||||||||
C52E12.2b.1:c.4621G>A | |||||||||
CE48050:p.Asp1497Asn | |||||||||
C52E12.2a.2:c.4489G>A | |||||||||
CE47855:p.Asp1541Asn | |||||||||
HGVSg | CHROMOSOME_II:g.7009630G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C52E12 | |||||
Flanking_sequences | ccatatattcttttattccgtgatgatcga | atttggttattcgaggaatcattaatctgg | |||||||
Mapping_target | C52E12 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00037788 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004283 | ||||||||
WBStrain00007435 | |||||||||
WBStrain00023451 | |||||||||
WBStrain00027316 | |||||||||
WBStrain00029041 | |||||||||
WBStrain00040211 | |||||||||
WBStrain00047182 | |||||||||
WBStrain00050611 | |||||||||
WBStrain00057260 | |||||||||
Laboratory | CB | ||||||||
MTS | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006831 | |||||||
Transcript | C52E12.2a.2 (12) | ||||||||
C52E12.2b.1 (12) | |||||||||
C52E12.2a.1 (12) | |||||||||
Interactor (44) | |||||||||
Genetics | Interpolated_map_position | II | 0.260775 | ||||||
Mapping_data | In_2_point | 948 | |||||||
3709 | |||||||||
In_multi_point (8) | |||||||||
In_pos_neg_data | 544 | ||||||||
548 | |||||||||
554 | |||||||||
597 | |||||||||
619 | |||||||||
4514 | |||||||||
Description | Phenotype | WBPhenotype:0000017 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ric | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00040570 | |||||||
Curator_confirmed | WBPerson8126 | ||||||||
Remark | (Fig.2) unc-104(e1265) animals exhibit no lifespan extension upon reserpine treatment, unlike wild type animals | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Affected_by | Molecule | WBMol:00002955 | Paper_evidence | WBPaper00040570 | |||||
Curator_confirmed | WBPerson8126 | ||||||||
WBPhenotype:0000164 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00040041 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit AVM ventral axon guidance defects. These defects can be suppressed by exogenous acetylcholine. DD and VD neurons migrate normally in these mutants and are unaffected by exogenous acetylcholine. | Paper_evidence | WBPaper00040041 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004765 | Paper_evidence | WBPaper00040041 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00040041 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||||
WBPaper00040857 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Localization of the synaptic protein SNB-1 accumulates in the cell body, based on expression analysis with SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
The fluorescence of SNB-1::VENUS was observed exclusively in the cell body of RIA in most of unc-104(e1265) mutant animals. | Paper_evidence | WBPaper00040857 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00001424 | |||||||
Curator_confirmed | WBPerson233 | ||||||||
Remark | several unc-104 alleles showed deficits in locomotion, feeding rate and defecation that varied in proportion to changes in synaptic vesicle transport within axons | Paper_evidence | WBPaper00001424 | ||||||
Curator_confirmed | WBPerson233 | ||||||||
WBPhenotype:0000565 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | severe coiler | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000604 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | defects in neuroanatomy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000672 | Paper_evidence | WBPaper00001424 | |||||||
Curator_confirmed | WBPerson233 | ||||||||
Remark | Figures 3 and 4 show changes in localization of synaptic vesicles in unc-104 alleles, with most vesicles concentrated in the neuron soma, while failing to reach chemical synaptic locales in the nerve ring | Paper_evidence | WBPaper00001424 | ||||||
Curator_confirmed | WBPerson233 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00030754 | |||||||
WBPaper00002911 | |||||||||
WBPaper00039901 | |||||||||
WBPaper00032443 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Localization of the pan-neuronal expressed preproANF::GFP is mislocalized to cell bodies in unc-104 mutants | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
GFP-tagged UNC-47 is localized in cell bodies rather than transported to neuromuscular junctions. | Paper_evidence | WBPaper00002911 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
The intensities of TIR-1::GFP puncta were significantly different between wild-type and unc-104(e1265) mutant animals. TIR-1::GFP puncta in the AWC axons were bright in wild-type animals but were faint in unc-104 mutants. | UNC-43::GFP and NSY-1::GFP showed significantly reduced levels of localization in the AWC axons. The expression level of UNC-43::GFP in the AWC cell body was similar in wild type and unc-104(e1265) mutants, whereas NSY-1::GFP expression was reduced in the AWC cell body in unc-104(e1265) mutants. | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
" In contrast to transgenic N2 animals , where CeNIPA : : EGFP was distributed in the cell soma and axons ( Fig . 7O ) , CeNIPA : : EGFP ; unc-104 ( e1265 ) / animals displayed EGFP labeling only in the somata of neurons ( Fig . 7 N ) ." | Paper_evidence | WBPaper00032443 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | tgIs5[Paex-3:ANF::GFP] unc-104(e1265) | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | ||||||||
[str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
CeNIPA : : EGFP | Paper_evidence | WBPaper00032443 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000853 | Paper_evidence | WBPaper00038442 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The speed of PTL-1 in unc-104 mutants is statistically significant lower compared to PTL-1 alone. | Paper_evidence | WBPaper00038442 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000962 | Paper_evidence | WBPaper00037623 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Fluorescence levels of APL-1::GFP are dramatically reduced compared to control animals. | Paper_evidence | WBPaper00037623 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001400 | Paper_evidence | WBPaper00037623 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Levels of APL-1 protein are reduced compared to control animals even though no difference was observed in message levels of apl-1 between control and mutant animals when assayed with qRT-PCR. | Paper_evidence | WBPaper00037623 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001479 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | poor response to dauer pheromone | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001716 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001752 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal transport of synaptic vesicles | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001922 | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In unc-104(e1265) mutants, the ratio of anterograde movement was significantly reduced to 33% and the ratio of retrograde movement was significantly increased to 67%, measured by time-lapse imaging of TIR-1::GFP puncta. However, the average speed of TIR-1 movement in either direction was not significantly altered in unc-104(e1265) mutants (data not shown). | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002288 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002293 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002295 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002300 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002301 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002308 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002323 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002336 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002344 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002347 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PKD-2::GFP localization is not different from wild type. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00032993 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | RSY-1DSR localization to presynaptic sites was not affected in unc-104 mutants, suggesting that RSY-1 is not associated with synaptic vesicles. | Paper_evidence | WBPaper00032993 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000962 | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The expression level of odr-3p::GFP in the AWC cell body is not significantly different between wild-type animals and unc-104(e1265) mutants. | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
WBPaper00039901 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Asymmetric expression in AWC was normal | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
unc-104(e1265) mutants did not show a 2AWC-ON phenotype. | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (34) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |