WormBase Tree Display for Variation: WBVar00143862
expand all nodes | collapse all nodes | view schema
WBVar00143862 | Evidence | Paper_evidence | WBPaper00004136 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1253 | |||||||
Other_name | F18C12.1.1:c.3546-1G>A | ||||||||
HGVSg | CHROMOSOME_I:g.8076322C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F18C12 | |||||
Flanking_sequences | gaagtgaaactaaaagcttcaaaatttgta | aggaaccacaattgaaaagttgaaattcgc | |||||||
Mapping_target | F18C12 | ||||||||
Type_of_mutation | Substitution | G | A | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004276 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000485 | |||||||
Transcript | F18C12.1.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F18C12.1.1:c.3546-1G>A | ||||||||
Intron_number | 15/48 | ||||||||
Genetics | Interpolated_map_position | I | 2.45385 | ||||||
Description | Phenotype | WBPhenotype:0000247 | Paper_evidence | WBPaper00000214 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants are 15% responsive to Na+ in a behavior orientation assay. WT worms are 95% responsive (based on sustained distance from attractant). | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants behave like WT in a Cl- gradient selection assay; however they are 10% responsive to Cl- in behavior orientation assay (based on sustained distance from attractant), WT are 70% responsive. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000256 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Amphidial neurons e though l are missing ciliated tips. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants form Dauers poorly. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants are lethargic | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency of 0, no detected matings. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000863 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant males are less potent than WT. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Occasional staining of CEP with FITC. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Occasional staining of ADE and PDE with FITC. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00002087 | |||||||
WBPaper00000932 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | defects in dye filling | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
No FITC staining by amphids or phasmids. | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002087 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of Ray sensilla. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (3) | |||||||||
Method | Substitution_allele |