WormBase Tree Display for Variation: WBVar00143752
expand all nodes | collapse all nodes | view schema
WBVar00143752 | Name | Public_name | e1111 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | W01C8.6.2:c.644G>A | ||||||||
CE35792:p.Trp215Ter | |||||||||
W01C8.6.1:c.644G>A | |||||||||
HGVSg | CHROMOSOME_X:g.5709743C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | E03E2 | |||||
Flanking_sequences | TTGCATTTGGAGATTCTTATTTCACACTAT | GTTGGCTAGAGCACTACAAGGCGTGGGGTC | |||||||
Mapping_target | E03E2 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00000365 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004245 | ||||||||
WBStrain00033387 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000295 | |||||||
Transcript | W01C8.6.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | W01C8.6.1:c.644G>A | ||||||||
HGVSp | CE35792:p.Trp215Ter | ||||||||
cDNA_position | 684 | ||||||||
CDS_position | 644 | ||||||||
Protein_position | 215 | ||||||||
Exon_number | 6/13 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
W01C8.6.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | W01C8.6.2:c.644G>A | ||||||||
HGVSp | CE35792:p.Trp215Ter | ||||||||
cDNA_position | 743 | ||||||||
CDS_position | 644 | ||||||||
Protein_position | 215 | ||||||||
Exon_number | 7/14 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000504903 | ||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000221 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dopamine and serotonin absent from neuron processes present in cell bodies; serotonin immunoreactivity restored by exogenous serotonin or 5-hydroxytryptophan | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004583 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004929 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000227 | Paper_evidence | WBPaper00001861 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | cat-1 males show variable reduction in turning ability, more than 50% good turns. Some males were perfect e.g. made good turns 100% of the time. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
poor male turning behavior | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000234 | Paper_evidence | WBPaper00000365 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dopamine levels are reduced in these mutants. | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000237 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | enhanced foraging behavior, suppressed by serotonin agonists | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Serotonin-IR (immunoreactivity) is variable, ranging from WT levels to a complete lack of staining, which can be restored by treatment with serotonin or its precursor, 5-HTP. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Serotonin levels are reduced in HSNs and 8 other serotonergic head neurons (determined immunocytochemically) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006837 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000648 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant males seem to be unable to track the hermaphrodite after contact, lose contact altogether, have difficulty escaping from spontaneous dorsal inward tail coils, and are more likely to ignore contact with a hermaphrodite. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001444 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited defective gustatory plasticity of NaCl. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl after various pre-treatments: a 15-min wash in CTX buffer with or without 100 mM NaCl (liquid), or 30 min on a CTX plate with or without 100 mM NaCl, and in the presence or absence of bacteria, 500 mM glycerol, or 3 uL of benzaldehyde. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001518 | Paper_evidence | WBPaper00000365 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Formaldehyde induced fluorescence is (FIF) is not seen in processes; however it is seen in cell bodies. | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00035654 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Five miRNAs were observed differentially expressed (p<0.05) in cat-1 mutants when compared to N2 wt | Paper_evidence | WBPaper00035654 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0004017 | Paper_evidence | WBPaper00042154 | |||||||
Curator_confirmed | WBPerson1455 | ||||||||
Remark | In free locomotion, coordination between head movement and body center movement reduces rapidly after third day of adult stage(Fig. 7). | Paper_evidence | WBPaper00042154 | ||||||
Curator_confirmed | WBPerson1455 | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Remark | Fig.1 (lifespan extension upon reserpine treatment, not different from wild type) | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Affected_by | Molecule | WBMol:00002955 | Paper_evidence | WBPaper00040570 | |||||
Curator_confirmed | WBPerson8126 | ||||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000365 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000525 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00000365 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Assayed by EM examination, vesicles and processes of the ventral ganglion and nerve ring are not different from WT. | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001206 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Models_disease | DOID:670 | |||||||
DOID:809 | |||||||||
Models_disease_in_annotation | WBDOannot00000684 | ||||||||
WBDOannot00000692 | |||||||||
Reference (16) | |||||||||
Method | Substitution_allele |