WormBase Tree Display for Variation: WBVar00143718
expand all nodes | collapse all nodes | view schema
WBVar00143718 | Name | Public_name | e1066 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | T07H8.4f.1:c.2950+1G>A | ||||||||
T07H8.4a.1:c.3517+1G>A | |||||||||
T07H8.4h.1:c.3514+1G>A | |||||||||
T07H8.4e.1:c.3358+1G>A | |||||||||
T07H8.4g.1:c.2308+1G>A | |||||||||
T07H8.4d.1:c.3481+1G>A | |||||||||
T07H8.4d.2:c.3481+1G>A | |||||||||
T07H8.4b.1:c.3505+1G>A | |||||||||
HGVSg | CHROMOSOME_V:g.6961420G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T07H8 | |||||
Flanking_sequences | aattccccaccgacatgcccatgtatggag | taaaattcaaataacaattgttccattttc | |||||||
Mapping_target | T07H8 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024622 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004236 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003165 | |||||||
Transcript | T07H8.4e.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07H8.4e.1:c.3358+1G>A | ||||||||
Intron_number | 13/27 | ||||||||
T07H8.4b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07H8.4b.1:c.3505+1G>A | ||||||||
Intron_number | 15/25 | ||||||||
T07H8.4a.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07H8.4a.1:c.3517+1G>A | ||||||||
Intron_number | 16/31 | ||||||||
T07H8.4h.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07H8.4h.1:c.3514+1G>A | ||||||||
Intron_number | 15/29 | ||||||||
T07H8.4d.2 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07H8.4d.2:c.3481+1G>A | ||||||||
Intron_number | 16/30 | ||||||||
T07H8.4f.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07H8.4f.1:c.2950+1G>A | ||||||||
Intron_number | 15/29 | ||||||||
T07H8.4g.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07H8.4g.1:c.2308+1G>A | ||||||||
Intron_number | 7/21 | ||||||||
T07H8.4d.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07H8.4d.1:c.3481+1G>A | ||||||||
Intron_number | 16/31 | ||||||||
Genetics | Interpolated_map_position | V | 0.482729 | ||||||
Mapping_data | In_2_point | 127 | |||||||
In_multi_point | 139 | ||||||||
140 | |||||||||
In_pos_neg_data | 844 | ||||||||
861 | |||||||||
1746 | |||||||||
Description | Phenotype | WBPhenotype:0000181 | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In mec-1 mutants, 8% of the NSM sub-ventral processes are absent and another 4% are short | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000247 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants behave like WT in a Na+ gradient assay and are mildy defective (90% responsive to Na+) in a behavior orientation assay. WT worms are 95% responsive (based on sustained distance from attractant). | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants are 75% responsive to Cl- in behavior orientation assay (based on sustained distance from attractant), WT are 70% responsive. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000256 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Amphid neurons partially fail to fasciculate. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000214 | |||||||
WBPaper00000502 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | touch insensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000632 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | defective fasciculation | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Intermediate response to dauer inducing conditions as assayed through SDS resistance of animals from a crowded, starved plate. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000653 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mechanosensory neurons are abnormal. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency 2; 1-10% of WT mating efficiency. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000972 | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Sheath cells of all sensory neurons are hypertrophied. | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001213 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants are lethargic in bacteria. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001310 | Paper_evidence | WBPaper00000502 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Cell bodies of anterior touch neurons displaced dorsally. | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
some amphidial neurons also displaced | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005391 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001398 | Paper_evidence | WBPaper00038449 | |||||||
Curator_confirmed | WBPerson3779 | ||||||||
WBPhenotype:0001534 | Paper_evidence | WBPaper00000502 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ECM support matrix is missing along the VC. | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
microtubule cells lack extracellular mantle often displaced | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001676 | Paper_evidence | WBPaper00038449 | |||||||
Curator_confirmed | WBPerson3779 | ||||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00055368 | |||||||
Curator_confirmed | WBPerson466 | ||||||||
Remark | survive 10nM ivermectin | Paper_evidence | WBPaper00055368 | ||||||
Curator_confirmed | WBPerson466 | ||||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00055368 | |||||
Curator_confirmed | WBPerson466 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ADF consistently stains with FITC, other amphid and phasmid neurons frequently stain but not consistently. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00038449 | ||||||
Curator_confirmed | WBPerson3779 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals respond normally to high concentrations of NaCl. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals respond normally to a dilute NaCl gradient. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC does not stain CEP. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001532 | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC does not stain ADE or PDE. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype (2) | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males exhibit continued tactile sexual behavior. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038449 | ||||||||
WBPaper00031671 | |||||||||
WBPaper00000932 | |||||||||
WBPaper00006052 | |||||||||
WBPaper00000214 | |||||||||
WBPaper00000502 | |||||||||
WBPaper00055368 | |||||||||
Method | Substitution_allele |