WormBase Tree Display for Variation: WBVar00143087
expand all nodes | collapse all nodes | view schema
WBVar00143087 | Name | Public_name | e286 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F30H5.1.1:c.2464C>T | ||||||||
CE01925:p.Leu822Phe | |||||||||
HGVSg | CHROMOSOME_III:g.500483C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F30H5 | |||||
Flanking_sequences | ccattttcagcccggaaccgatcgtctgaaa | tctgggttctctactcggcagaagttgaaga | |||||||
Mapping_target | F30H5 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003295 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004142 | ||||||||
WBStrain00006360 | |||||||||
WBStrain00026328 | |||||||||
WBStrain00033497 | |||||||||
WBStrain00033521 | |||||||||
WBStrain00034257 | |||||||||
WBStrain00035413 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Isolation | Mutagen | hydroxylamine | |||||||
Genetics | Interpolated_map_position | III | -26.82 | ||||||
Mapping_data | In_2_point (3) | ||||||||
In_multi_point | 67 | ||||||||
856 | |||||||||
857 | |||||||||
1580 | |||||||||
1628 | |||||||||
1630 | |||||||||
1632 | |||||||||
2337 | |||||||||
2338 | |||||||||
3291 | |||||||||
Description | Phenotype | WBPhenotype:0000306 | Paper_evidence | WBPaper00040187 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | UCS accumulation was significantly lower than that of the other transgenic products, TPR(-) UCS(-), and full-length UNC-45. | Paper_evidence | WBPaper00040187 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000349 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | at 25C limp | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000509 | Paper_evidence | WBPaper00000536 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Only 3.4% of sperm have pseudopods, some of these cells have filaments. | Paper_evidence | WBPaper00000536 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006798 | PATO:0000460 | Paper_evidence | WBPaper00000536 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | at 25C Egl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00046852 | |||||||
Person_evidence | WBPerson2251 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson2987 | |||||||||
Remark | "A single amino acid substitute in the UCS domain of C-elegans UNC-45, E781K, or L822F (the m94 and e286 alleles, respectively), results in temperature-sensitive motility defects (Figure 1B) and myosin disorganization phenotypes (Figure 1C) when animals are grown at restrictive conditions (>22 degrees Celsius). However, animals show no phenotypes during development and early adulthood when grown at the permissive temperature (15 degrees Celsius C)." | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00044758 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson5063 | |||||||||
Remark | At 25C paralyzed; males move better; at 20C slow, at 15C wildtype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
temperature sensitive phenotype rescued by FUdR | Paper_evidence | WBPaper00044758 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00044758 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson5063 | |||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000782 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | few thick filaments | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000861 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | defect in body muscle cells | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000926 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | defect in body muscle cells | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
muscle ultrastructure defective | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001213 | Paper_evidence | WBPaper00040187 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Full length UNC-45, TPR(-)UNC-45 and UCS(only) UNC-45, but not the UCS(-)UNC-45 construct were able to rescue the motility defect of e286 at the 25 deg C restrictive temperature. | Paper_evidence | WBPaper00040187 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00040187 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001292 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | defect in body muscle cells | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001403 | Paper_evidence | WBPaper00046852 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Animals expressing unc-45(e286) or unc-45(m94) that were shifted to restrictive conditions after the first larval stage exhibited disruption of myofilament structure associated with mislocalization of MYO-3, while wild-type animals were unaffected (Figure 3B)." | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001414 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001569 | Paper_evidence | WBPaper00040187 | |||||||
WBPaper00046852 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | e286 worms grown at 25 deg C had abnormal thick filament assembly with no detectable myosin organization. A-band assembly was rescued in transgenic full length, TPR(-) and UCS(only) animals, but not in the UCS(-) transgenic animal. | Paper_evidence | WBPaper00040187 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
"A single amino acid substitute in the UCS domain of C-elegans UNC-45, E781K, or L822F (the m94 and e286 alleles, respectively), results in temperature-sensitive motility defects (Figure 1B) and myosin disorganization phenotypes (Figure 1C) when animals are grown at restrictive conditions (>22 degrees Celsius). However, animals show no phenotypes during development and early adulthood when grown at the permissive temperature (15 degrees Celsius C)." | Paper_evidence | WBPaper00046852 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00040187 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001889 | Paper_evidence | WBPaper00046852 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Animals expressing unc-45(e286) or unc-45(m94) that were shifted to restrictive conditions after the first larval stage exhibited disruption of myofilament structure associated with mislocalization of MYO-3, while wild-type animals were unaffected (Figure 3B)." | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000518 | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "A single amino acid substitute in the UCS domain of C-elegans UNC-45, E781K, or L822F (the m94 and e286 alleles, respectively), results in temperature-sensitive motility defects (Figure 1B) and myosin disorganization phenotypes (Figure 1C) when animals are grown at restrictive conditions (>22 degrees Celsius). However, animals show no phenotypes during development and early adulthood when grown at the permissive temperature (15 degrees Celsius C)." | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00046852 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Remark | At 15C animals are WT on control RNAi but are fully paralyzed on daf-21, C01G10.8, sti-1 or ZC395.10 RNAi. WT animals do not show paralysis when treated with these RNAi. | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson5063 | ||||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson5063 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (12) | |||||||||
Method | Substitution_allele |