WormBase Tree Display for Variation: WBVar00089478
expand all nodes | collapse all nodes | view schema
WBVar00089478 | Evidence | Person_evidence | WBPerson27644 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n389 | |||||||
Sequence_details | SMap | S_parent | Sequence | ZC247 | |||||
Flanking_sequences | cactgtgctcggaaaatgctggcatcagtc | ttgaacatttctaattctaaatattatagt | |||||||
Mapping_target | ZC247 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00013859 | |||||||
WBGene00201104 | |||||||||
WBGene00013860 | |||||||||
WBGene00003000 | |||||||||
Transcript | ZC247.3.1 | ||||||||
ZC247.2.1 | |||||||||
ZC247.1.1 | |||||||||
ZC247.6 | |||||||||
Interactor (16) | |||||||||
Genetics | Interpolated_map_position | I | 4.79669 | ||||||
Mapping_data | In_2_point | 3202 | |||||||
In_multi_point | 402 | ||||||||
403 | |||||||||
In_pos_neg_data | 748 | ||||||||
756 | |||||||||
765 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00000762 | |||||
WBPaper00005357 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson2987 | |||||||||
Remark | "We next analyzed the ability of individual lin-11-A and lin-11-B element to rescue the egg-laying defect of lin-11(n389) animals." | Paper_evidence | WBPaper00005357 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000093 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 2ary vulval cell lineages become symmetrical | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | 100% | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000393 | Paper_evidence | WBPaper00041660 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ACs fail to migrate and are located on the vulval apex in most animals. | Paper_evidence | WBPaper00041660 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00041660 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004522 | PATO:0000460 | Paper_evidence | WBPaper00041660 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00004906 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The AWA neurons adopt partial AWC-like fate in lin-11 mutants. 12% of lin-11(n389) mutants ectopically express tax-2::GFP in at least one AWA neuron. lin-11 mutants express str-2::GFP ectopically in at least one AWA neuron. Few lin-11(n389) mutant animals express str-2::GFP in ASG | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00004906 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005664 | PATO:0000460 | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | kyIs111 (tax-2::GFP), kyIs140 (str-2::GFP) | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00004906 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | lin-11(n389) alters odr-7 expression in AWA | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00004906 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | ODR-7 antibody staining | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000510 | Paper_evidence | WBPaper00005357 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By contrast, lin-11(n389) animals have abnormal vulval invagination and no visible utse (Fig. 3C) and anchor cell (AC) remains located on the vulval apex causing a physical block in the egg-laying passage (Newman et al., 1999; Fig. 3C)." | Paper_evidence | WBPaper00005357 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00005357 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000533 | Paper_evidence | WBPaper00005357 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By contrast, lin-11(n389) animals have abnormal vulval invagination and no visible utse (Fig. 3C) and anchor cell (AC) remains located on the vulval apex causing a physical block in the egg-laying passage (Newman et al., 1999; Fig. 3C)." | Paper_evidence | WBPaper00005357 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006789 | PATO:0000460 | Paper_evidence | WBPaper00005357 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00005357 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Furthermore, cog-2::GFP expression reveals defects in the migration of π progeny (Fig. 3D)." | Paper_evidence | WBPaper00005357 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007813 | PATO:0000460 | Paper_evidence | WBPaper00005357 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | cog-2::GFP | Paper_evidence | WBPaper00005357 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000762 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | hermaphrodite slightly uncoordinated; adult male slightly uncoordinated | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | 100% | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000057 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000056 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00000762 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | 97 percent of Vul hermaphrodites have a single ventral protrusion | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
adult hermaphrodite vulvaless (penetrance 100%) | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
100% | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00005357 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The ectopic vulval invagination defect of lin-17(sy277) animals was completely suppressed by lin-11(n389) (n = 300; Table 1)." | Paper_evidence | WBPaper00005357 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00004906 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | lin-11(n389) alters odr-7, gpa-5 and odr-10 expression in AWA | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00004906 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | pkIs582 (gpa-5::GFP), kyIs37 (odr-10::GFP), odr-7::GFP | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | male mating is completely abolished | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1467) | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001508 | Paper_evidence | WBPaper00005357 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By contrast, lin-11(n389) animals have abnormal vulval invagination and no visible utse (Fig. 3C) and anchor cell (AC) remains located on the vulval apex causing a physical block in the egg-laying passage (Newman et al., 1999; Fig. 3C)." | Paper_evidence | WBPaper00005357 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004522 | PATO:0000460 | Paper_evidence | WBPaper00005357 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001510 | Paper_evidence | WBPaper00004906 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Loss of ASG-specific gene expression in lin-11 mutants | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005664 | PATO:0000460 | Paper_evidence | WBPaper00004906 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | ops-1::GFP, Ex[unc-30::GFP], lim-6::GFP | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001526 | Paper_evidence | WBPaper00004906 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In lin-11 mutants, the cilia of the AWA neurons acquire a morphology intermediate between those of AWA and AWC | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00004906 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000717 | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | lin-11 mutants do not exhibit gene expression defects in ASH, ADL, ADF, ASER, ASEL, AWB, ASI, AFD and AVA | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | ntIs1 (gcy-5::GFP), oyIs17 (gcy-8::GFP), kyIs128 (str-3::GFP), kyIs104 (str-1::GFP), oyIs14 (sra-6::GFP), otIs24 (sre-1::GFP), oyIs34 (T08G3.3::GFP), kyIs5 (ceh-23::GFP), kyIs29 (glr-1::GFP), lim-6p::GFP and gmIs12 (srb-6::GFP) | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with gcy-7 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs3 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00004906 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | lin-11 mutants do not exhibit defects in DiI filling | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DiI filling | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (11) | |||||||||
Remark | Deletion also affects two adjacent genes ZC247.1 and ZC247.2 | Person_evidence | WBPerson27644 | ||||||
Curator_confirmed | WBPerson51134 | ||||||||
Variation information submitted by WBPerson27644 on 2023-05-31_19:01:43 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||||
Method | Deletion_allele |