WormBase Tree Display for Variation: WBVar00088333
expand all nodes | collapse all nodes | view schema
WBVar00088333 | Evidence | Paper_evidence | WBPaper00003386 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ku194 | |||||||
Other_name (17) | |||||||||
HGVSg | CHROMOSOME_X:g.5672291C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | W01C8 | |||||
Flanking_sequences | ctcctgaggcagcacgaactgatgcagcat | agcagcaacaaatgataattgctaacatgt | |||||||
Mapping_target | W01C8 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003386 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00001182 | |||||||
Transcript (11) | |||||||||
Interactor | WBInteraction000501481 | ||||||||
WBInteraction000501482 | |||||||||
WBInteraction000501869 | |||||||||
WBInteraction000520308 | |||||||||
WBInteraction000555306 | |||||||||
Genetics | Interpolated_map_position | X | -4.407 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00003386 | |||||
WBPaper00006298 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 96% (n=93) of animals are completely unable to lay eggs. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
WBPaper00006298 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Average brood size 2811 s.d. (n=55). Brood size was assayed by counting all progeny that emerged from an Egl corpse. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000283 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 81% (n=53) of animals with normal vulval morphology exhibited an AC block, e.g. the AC nucleus had not migrated from the apex of the vulva. N2 exhibits 0% AC block (n-32). | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000464 | Paper_evidence | WBPaper00042395 | |||||||
Curator_confirmed | WBPerson1725 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 4% (n=93) of animals produce no progeny. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000690 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 13% (n=82) gonad arms followed and abnormal migration path as viewed under Nomarski optics, compared to N2 (3%(n=108)). | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 19% (n=53)of animals exhibit grossly abnormal vulva morphology as compared to N2 (3%(n=32)). | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 44% (n=183) of animals have a protruding vulva. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000746 | Paper_evidence | WBPaper00006298 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 22/24 pi cell daughters were observed dividing (2 animals scored). No pi cell daughters were observed to undergo divisions in N2 animals. | Paper_evidence | WBPaper00006298 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007813 | PATO:0000460 | Paper_evidence | WBPaper00006298 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00006298 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000825 | Paper_evidence | WBPaper00006298 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | As assayed by extra cell divisions of pi daughter cells as well as by an increase in the average number of fluorescent uterine nuclei compared to egl-13(+) animals. | Paper_evidence | WBPaper00006298 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007813 | PATO:0000460 | Paper_evidence | WBPaper00006298 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00006298 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | tyIs4[egl-13::GFP] | Paper_evidence | WBPaper00006298 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00006298 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The average number of fluorescent uterine nuclei was increased in comparison to egl-13(+) animals. | Paper_evidence | WBPaper00006298 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007813 | PATO:0000460 | Paper_evidence | WBPaper00006298 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00006298 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kuIs29[egl-13::GFP] or tyIs4[egl-13::GFP] | Paper_evidence | WBPaper00006298 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00006298 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | AC nucleus does not express kuIs29[egl-13::GFP]. | Paper_evidence | WBPaper00006298 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004522 | PATO:0000460 | Paper_evidence | WBPaper00006298 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00006298 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kuIs29[egl-13::GFP] or tyIs4[egl-13::GFP] | Paper_evidence | WBPaper00006298 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001764 | Paper_evidence | WBPaper00042395 | |||||||
Curator_confirmed | WBPerson1725 | ||||||||
Phenotype_not_observed | WBPhenotype:0000197 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pi cell precursors adopt a pi fate, as assayed by their division patterns (56/63 cells lineaged) and the expression of pi-cell specific markers lin-11::gfp and cog-2::gfp in ku194 animals. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007813 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00042395 | ||||||||
WBPaper00003386 | |||||||||
WBPaper00006298 | |||||||||
Method | Substitution_allele |