WormBase Tree Display for Variation: WBVar00000460
expand all nodes | collapse all nodes | view schema
WBVar00000460 | Evidence | Paper_evidence | WBPaper00048626 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | Y87G2A | |||||
Flanking_sequences | tgcccggatacgataaaaaaatcgaattcg | cgtgctcaactcgttcgcctacaagattca | |||||||
Mapping_target | Y87G2A | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00048626 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000261 | ||||||||
WBStrain00030635 | |||||||||
WBStrain00030636 | |||||||||
WBStrain00034434 | |||||||||
WBStrain00056203 | |||||||||
WBStrain00056208 | |||||||||
WBStrain00056254 | |||||||||
Component_of_genotype | WBGenotype00000069 | ||||||||
WBGenotype00000159 | |||||||||
Laboratory | SS | ||||||||
SJZ | |||||||||
Status | Live | ||||||||
Linked_to | WBVar02144875 | ||||||||
WBVar02144876 | |||||||||
WBVar02144874 | |||||||||
Affects | Gene | WBGene00006936 | |||||||
Transcript | Y87G2A.5.1 (12) | ||||||||
Interactor (18) | |||||||||
Genetics | Gene_class | glp | |||||||
Interpolated_map_position | I | 21.4559 | |||||||
Mapping_data | In_2_point | 6106 | |||||||
6107 | |||||||||
In_multi_point | 2176 | ||||||||
2177 | |||||||||
3241 | |||||||||
3242 | |||||||||
3380 | |||||||||
3429 | |||||||||
In_pos_neg_data | 6688 | ||||||||
6689 | |||||||||
6690 | |||||||||
6691 | |||||||||
6692 | |||||||||
6693 | |||||||||
6694 | |||||||||
Description | Phenotype | WBPhenotype:0000038 | Paper_evidence | WBPaper00050044 | |||||
Curator_confirmed | WBPerson17144 | ||||||||
Remark | Increase rupture post-reproductively | Paper_evidence | WBPaper00050044 | ||||||
Curator_confirmed | WBPerson17144 | ||||||||
WBPhenotype:0000120 | Paper_evidence | WBPaper00027619 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | CPB-3 was barely detected in an extract of glp-4(bn2) adult animals cultured at the restrictive temperature | Paper_evidence | WBPaper00027619 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00027619 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | anti-CPB-3 staining | Paper_evidence | WBPaper00027619 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00040043 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | cki-2 mRNA is absent from germline-less glp-4(bn2ts) animals. | Paper_evidence | WBPaper00040043 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00031962 | |||||||
WBPaper00004137 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | Expression of prg-2 mRNA was severely reduced compared with levels in wild-type as demonstrated by quantitative RT-PCR on total RNA isolated from 12-hour adult animals grown at 25C. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
ego-1 transcripts were barely detectable in glp-4 mutants | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00031962 | |||||
Curator_confirmed | WBPerson712 | ||||||||
25C | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Northern blot analysis | Paper_evidence | WBPaper00004137 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000202 | Paper_evidence | WBPaper00035486 | |||||||
Curator_confirmed | WBPerson3490 | ||||||||
Phenotype_assay | Genotype | apl-1::gfp::unc-54(3'UTR) | Paper_evidence | WBPaper00035486 | |||||
Curator_confirmed | WBPerson3490 | ||||||||
WBPhenotype:0000215 | Paper_evidence | WBPaper00031961 | |||||||
WBPaper00005597 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00005597 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000313 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Germ cells arrested at meiotic prophase. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000394 | Paper_evidence | WBPaper00031961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PLG-1 was not detectable in Western blots of protein lysates. | Paper_evidence | WBPaper00031961 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000396 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | non-reflexed gonad arms | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00064734 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | hermaphrodites raised at 25C sterile,~12 germ line nuclei, males at 25C ~16 germ line nuclei, normal soma. Fertile at 16C; TSP throughout larval development | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000812 | Paper_evidence | WBPaper00031962 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are devoid of germ cells. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00031962 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00031962 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000823 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | hermaphrodites raised at 25C sterile,~12 germ line nuclei, males at 25C ~16 germ line nuclei, normal soma. Fertile at 16C; TSP throughout larval development | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00035490 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | glp-4 mutants enhanced nematode survival in the presence of the pathogen Pseudomonas aeruginosa and S. marcescens | Paper_evidence | WBPaper00035490 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00032310 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | glp-4(bn2ts) mutants exhibited reduced fat content at the non-permissive temperature of 25 degrees Celsius, compared to wild type controls (Figure 1D-G) | Paper_evidence | WBPaper00032310 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | 250 microliters of Nile Red (Molecular Probes) solution (1 microgram per milliliter in 1 X PBS) or C1-BODIPYC12 (Molecular Probes) solution (2 micromolar in 1 X PBS) was applied to the surface of NGM (Nematode Growth Media) plates (~12 milliliters of agar) seeded with E. coli OP50. Plates were used immediately after dry in a laminar flow hood (for C1-BODIPY-C12 staining) or allowed to equilibrate overnight at room temperature (for Nile Red staining). For Nile Red staining, synchronized animals were grown on Nile Red-containing plates since L1 larval stage and taken pictures at adulthood. For C1-BODIPY-C12 staining, animals were transferred from NGM plates onto C1-BODIPY-C12-containing plates at L4 larval stage and taken pictures at adulthood.Quantification of Nile Red and C1-BODIPY-C12 staining was performed according to Mak et al (1). Fluorescence images were captured using a Zeiss Axioplan microscope and a CCD camera (Hamamatsu, ORCA-ER). To quantify fluorescence intensity, images of the anterior intestine were captured from animals whose anterior intestine was not covered by the gonad. The images were collected at 12-bit with the raw pixel values within the linear range of the CCD camera that is controlled by an "automatic exposure" function with the Openlab software (Improvision). To calculate the fluorescence intensity, the mean pixel intensity of all fluorescence staining lipid droplets in the first 3 pairs of intestinal cells were divided by the exposure time (Openlab, Improvision). For each genotype, the average of 15~20 animals was presented. | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00032310 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | |||||||
WBPaper00031961 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 21UR-1 was absent from animals at the restrictive temperature, which are devoid of germ cells. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
21U-RNA-1 and 21U-RNA-3442 RNAs were absent from RNA preparations, whereas, 21U-RNAs were expressed at approximately equal levels in male or female-enriched populations of wild-type animals. | Paper_evidence | WBPaper00031961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00031962 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00031962 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001776 | Paper_evidence | WBPaper00031961 | |||||||
WBPaper00035324 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | Animals exhibited a severe depletion of endogenous siRNAs. | Paper_evidence | WBPaper00031961 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
The glp-4 mutant exhibits an approximately 50% decline in 21-nt siRNA expression, but a complete loss of 26G RNAs | Paper_evidence | WBPaper00035324 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00035324 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00035664 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Gonadless animals fail to express miRNAs 35-41 at levels detectable by northern blots | Paper_evidence | WBPaper00035664 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00035664 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001823 | Paper_evidence | WBPaper00028527 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Male sperm failed to accumulate in the spermatheca in glp-4(bn2) mutants at the restrictive temperature | Paper_evidence | WBPaper00028527 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028527 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00028527 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Wild-type males labelled with MitoTracker were mated to non-labelled mutant hermaphrodites | Paper_evidence | WBPaper00028527 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001861 | Paper_evidence | WBPaper00005597 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | With a missing germline, induction of germline expressed transcripts is abrogated, as in the case with irradiation induced egl-1. In contrast to wild-type worms, bn2 mutants show a significant decrease in induction of egl-1 in response to X-ray irradiation. | Paper_evidence | WBPaper00005597 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00005597 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001182 | Paper_evidence | WBPaper00032310 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | glp-4(bn2ts) mutants exhibited normal fat content at the permissive temperature of 15 degrees Celsius, compared to wild type controls, as determined by Nile Red staining (Figure S3C,D) | Paper_evidence | WBPaper00032310 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001266 | Paper_evidence | WBPaper00035490 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Nematodes containing a mutation in either glp-1 or glp-4 did not have substantially more phospho-PMK-1 than did wild-type nematodes | Paper_evidence | WBPaper00035490 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002534 | Paper_evidence | WBPaper00005130 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The accumulation of both abf-1 and abf-2 transcripts was almost identical in adults of N2 and glp-4(bn2), and the eggs. | Paper_evidence | WBPaper00005130 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (36) | |||||||||
Method | Substitution_allele |