WormBase Tree Display for Variation: WBVar00143951
expand all nodes | collapse all nodes | view schema
WBVar00143951 | Evidence | Paper_evidence | WBPaper00004623 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1372 | |||||||
Other_name | B0412.2.1:c.369+1G>A | ||||||||
HGVSg | CHROMOSOME_III:g.812434G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0412 | |||||
Flanking_sequences | aatgatttggaaagaagcgatattcttcag | tatcgtttggtttttttttaaaaagaatcc | |||||||
Mapping_target | B0412 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004623 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000063 | ||||||||
WBStrain00004310 | |||||||||
WBStrain00005597 | |||||||||
WBStrain00006202 | |||||||||
WBStrain00006360 | |||||||||
WBStrain00022755 | |||||||||
WBStrain00023548 | |||||||||
WBStrain00026329 | |||||||||
WBStrain00026330 | |||||||||
WBStrain00026331 | |||||||||
WBStrain00035147 | |||||||||
WBStrain00035150 | |||||||||
WBStrain00050822 | |||||||||
WBStrain00050823 | |||||||||
WBStrain00050824 | |||||||||
WBStrain00050825 | |||||||||
WBStrain00050852 | |||||||||
WBStrain00051573 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000903 | |||||||
Transcript | B0412.2.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0412.2.1:c.369+1G>A | ||||||||
Intron_number | 3/6 | ||||||||
Interactor (86) | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00004623 | |||||
Genetics | Interpolated_map_position | III | -25.7993 | ||||||
Mapping_data | In_2_point | 273 | |||||||
422 | |||||||||
423 | |||||||||
2720 | |||||||||
2721 | |||||||||
4974 | |||||||||
6130 | |||||||||
In_multi_point (25) | |||||||||
In_pos_neg_data | 1585 | ||||||||
1592 | |||||||||
Description | Phenotype | WBPhenotype:0000004 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Type C Egl at all temperatures | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000005 | Person_evidence | WBPerson3520 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson3520 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Genotype | daf-7(e1372)III | Person_evidence | WBPerson3520 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000006 | Paper_evidence | WBPaper00032082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All these animals retained ~24 eggs compared with wild type animals that retain ~10 eggs. | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Young well-fed animals were scored | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000007 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Late stage eggs are laid. | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000012 | Paper_evidence | WBPaper00000316 | |||||||
WBPaper00000502 | |||||||||
WBPaper00001923 | |||||||||
WBPaper00028386 | |||||||||
WBPaper00032073 | |||||||||
WBPaper00002600 | |||||||||
WBPaper00002914 | |||||||||
WBPaper00060603 | |||||||||
Person_evidence | WBPerson3520 | ||||||||
WBPerson261 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Not dauer constitutive at 15 C. | Person_evidence | WBPerson3520 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recovered by selection for resistance to 1% SDS. | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Weakly dominant for Dauer constitutive. | Paper_evidence | WBPaper00001923 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals formed less than 10% dauer at 16C. | Paper_evidence | WBPaper00028386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Low Daf-c at 15C but 100% Daf-c at 25C. | Paper_evidence | WBPaper00032073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Low levels of dauer worms are observed at 15 and 20 deg C. At 25 deg C, 100% of the animals are dauer. | Paper_evidence | WBPaper00002600 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
constitutive dauer formation at 25C reversible at 15C | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Embryos from each strain were incubated at 24 degC for 50-52 hours to induce dauer formation. As expected, 100% of larvaein the control daf-7 strain were dauers (Fig. 1A). | Paper_evidence | WBPaper00060603 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000316 | |||||||
WBPaper00000502 | |||||||||
Person_evidence | WBPerson3520 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson3520 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
25 | Paper_evidence | WBPaper00000316 | |||||||
WBPaper00000502 | |||||||||
WBPaper00028386 | |||||||||
WBPaper00032073 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16 | Paper_evidence | WBPaper00028386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
15, 25 | Paper_evidence | WBPaper00032073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
24 deg C | Paper_evidence | WBPaper00060603 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | daf-7(e1372)III | Person_evidence | WBPerson3520 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
unc-4(e120) | Paper_evidence | WBPaper00028386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00032082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Well-fed, pheromone-untreated daf-7(e1372) pumped at 81% of the wild-type rate. | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Pumping rates were assayed for well-fed , pheromone-untreated; food-deprived, pheromone-untreated; and well-fed, pheromone-treated animals. Pheromone treatment consisted of transfer of animals grown under well-fed conditions to plates containing 30 ul/ml of a dauer-pheromone prep (Golden and Riddle, 1982) and 30 ml of OP50 E. coli food. | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000127 | Paper_evidence | WBPaper00031997 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 5.30.27% animals (n=529) recovered at 25C 24 hours after transfer to pre-equilibrated plate. | Paper_evidence | WBPaper00031997 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00031997 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00031997 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00033456 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | pde-1 and ins-7 mRNA expression was decreased in daf-7 mutants compared to N2. PDE-5 and DAF-28 expression was unaltered. | Paper_evidence | WBPaper00033456 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000294 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dark intestine | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000295 | Paper_evidence | WBPaper00038374 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure S13C | Paper_evidence | WBPaper00038374 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000408 | Paper_evidence | WBPaper00002600 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | After 48 hours at 25 deg C, only a fraction of animals recover from dauer, whereas a significant proportion of animals that entered dauer at lower temperatures do recover. | Paper_evidence | WBPaper00002600 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000660 | Paper_evidence | WBPaper00005511 | |||||||
WBPaper00041877 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson6468 | |||||||||
Remark | daf-7 mutants aggregate and border on food, although less strongly than npr-1 mutant animals | Paper_evidence | WBPaper00005511 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00005511 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005511 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000964 | Paper_evidence | WBPaper00037649 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | partially resistant | Paper_evidence | WBPaper00037649 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00032501 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants had enhanced susceptibility to killing by PA14 than N2 | Paper_evidence | WBPaper00032501 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001072 | Paper_evidence | WBPaper00035327 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant behavior on aztreonam-treated bacteria was altered compared to wild type. Mutants continued to dwell in unfavorable food conditions | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032082 | |||||||
WBPaper00035322 | |||||||||
WBPaper00002914 | |||||||||
WBPaper00002847 | |||||||||
WBPaper00042308 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
WBPerson557 | |||||||||
Remark | Late-larval and early-adult animals accumulated ~2.5-fold more fat relative to wild-type animals, as determined by Sudan Black assay as described in Kimura et al., 1997. | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Fat stores in daf-2 and daf-7 mutants were high compared to wild type feeding on OP50 as well as on HB101 | Paper_evidence | WBPaper00035322 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Metabolic shifts, similar to daf-2 mutants are seen in daf-7 mutants. | Paper_evidence | WBPaper00002847 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
The daf-7(e1372) mutants exhibited a 14 percent increase in fat as judged by staining with BODIPY 493/503. | Paper_evidence | WBPaper00042308 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Oil Red O staining used as a proxy for fat mass. | Paper_evidence | WBPaper00042308 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002847 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | To minimize staining variability, which allowed for quantitative comparisons between various genotypes: animals from one genotype were labeled with fluorescein isothiocyanate (FITC) and then fixed and stained in the same tube as unlabeled animals from another genotype. | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 22 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00057227 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There was a significant increase in both the intensity (p=0.002) (Figure 1B) and width (p=0.008) (Figure 1C) of GLR-1::GFP puncta in the daf-7(e1372) mutants as compared to wild type. | Paper_evidence | WBPaper00057227 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014919 | Paper_evidence | WBPaper00057227 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005829 | PATO:0000460 | Paper_evidence | WBPaper00057227 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15degC | Paper_evidence | WBPaper00057227 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | KP3079 daf-7(e1372)III; nuIs24(Pglr-1:glr-1::gfp)IV | Paper_evidence | WBPaper00057227 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001258 | Paper_evidence | WBPaper00026769 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00026769 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00026769 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00032073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The expression of cuIs5 (or cuIs2), a reporter of TGF-beta -signaling activity, is barely visible, unlike in control animals. | Paper_evidence | WBPaper00032073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | cuIs5 or cuIs2 | Paper_evidence | WBPaper00032073 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001291 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | clumpy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001472 | Paper_evidence | WBPaper00061941 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | adult vs (dauer larvae)DL response difference was not observed in daf-2 towards IAA or daf-7 towards 2,3-butanedione and 2,3-pentanedione. | Paper_evidence | WBPaper00061941 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00061941 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00061941 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001506 | Paper_evidence | WBPaper00057227 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | the rate of spontaneous reversals is increased in daf-7(e1372) mutants maintained at 15C as compared to wild type maintained at 15C (n=11 of each genotype, p=0.000003). | Paper_evidence | WBPaper00057227 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014919 | Paper_evidence | WBPaper00057227 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15degC | Paper_evidence | WBPaper00057227 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | KP3079 daf-7(e1372)III; nuIs24(Pglr-1:glr-1::gfp)IV | Paper_evidence | WBPaper00057227 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00035327 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants of the TGF-beta peptide gene daf-7 were deficient roamers in standard conditions | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001654 | Paper_evidence | WBPaper00004599 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | daf-7(e1372) mutant animals exhibited a modest resistance to cadmium (Figure 1A) | Paper_evidence | WBPaper00004599 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00004599 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001687 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Srf-6 at 16C | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Cold_sensitive | 16 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001690 | Paper_evidence | WBPaper00002589 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals bind mAb M37 at stages L1-L4 but not as adults, wildtype worms only bind this anti-body at the L1 stage. Animals in dauer stage do not bind mAb 37, similar to wildtype. | Paper_evidence | WBPaper00002589 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Pentrance ranged from 87-100%. | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16, 25 | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001733 | Paper_evidence | WBPaper00032082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The pumping rate of food-deprived, pheromone-untreated young-adult animals alone was reduced to the same basal level as wild-type; however, the pumping-rate of well-fed, pheromone-treated animals was not reduced, as observed for WT. | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Pumping rates were assayed for well-fed , pheromone-untreated; food-deprived, pheromone-untreated; and well-fed, pheromone-treated animals. Acute pheromone treatment consisted of the transfer of animals grown under well-fed conditions to plates containing 30 ul/ml of a dauer-pheromone prep (Golden and Riddle, 1982) and 30 ml of OP50 E. coli food. | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Acute CO2 avoidance is reduced | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001820 | Paper_evidence | WBPaper00041877 | |||||||
Curator_confirmed | WBPerson6468 | ||||||||
Remark | Bordering is stronger in L4 animals than in adults. Compare Figure 4 to Figure S3 | Paper_evidence | WBPaper00041877 | ||||||
Curator_confirmed | WBPerson6468 | ||||||||
WBPhenotype:0001837 | Paper_evidence | WBPaper00050676 | |||||||
Curator_confirmed | WBPerson20840 | ||||||||
Remark | does not respond to dietary restriction | Paper_evidence | WBPaper00050676 | ||||||
Curator_confirmed | WBPerson20840 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00050676 | ||||
Curator_confirmed | WBPerson20840 | ||||||||
WBPhenotype:0002262 | Paper_evidence | WBPaper00057227 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There was a significant increase in both the intensity (p=0.002) (Figure 1B) and width (p=0.008) (Figure 1C) of GLR-1::GFP puncta in the daf-7(e1372) mutants as compared to wild type. | Paper_evidence | WBPaper00057227 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014919 | Paper_evidence | WBPaper00057227 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005829 | PATO:0000460 | Paper_evidence | WBPaper00057227 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15degC | Paper_evidence | WBPaper00057227 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | KP3079 daf-7(e1372)III; nuIs24(Pglr-1:glr-1::gfp)IV | Paper_evidence | WBPaper00057227 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002355 | Paper_evidence | WBPaper00045859 | |||||||
Curator_confirmed | WBPerson25803 | ||||||||
Remark | Figure 1 | Paper_evidence | WBPaper00045859 | ||||||
Curator_confirmed | WBPerson25803 | ||||||||
WBPhenotype:0002378 | Paper_evidence | WBPaper00045859 | |||||||
Curator_confirmed | WBPerson25803 | ||||||||
Remark | Figure 1 | Paper_evidence | WBPaper00045859 | ||||||
Curator_confirmed | WBPerson25803 | ||||||||
WBPhenotype:0002560 | Paper_evidence | WBPaper00058743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | npr-1 and daf-7 behaved similarly on the agar plates with perforations, where they were more likely to burrow than the wild-type strain (npr-1 vs. N2: Chi2=4.79, p=0.03; OR=1.63, 95% CI=1.04-2.52; daf-7 vs. N2: Chi2=5.23, p=0.02; OR=1.66, 95% CI=1.07-2.57) (Figure 1) | Paper_evidence | WBPaper00058743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014929 | Paper_evidence | WBPaper00058743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed (15) | |||||||||
Reference (65) | |||||||||
Method | Substitution_allele |