WormBase Tree Display for Variation: WBVar00143035
expand all nodes | collapse all nodes | view schema
WBVar00143035 | Evidence | Paper_evidence | WBPaper00004275 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e205 | |||||||
Other_name | JC8.10b.1:c.2708G>A | ||||||||
JC8.10a.1:c.2690G>A | |||||||||
CE29050:p.Trp903Ter | |||||||||
CE28239:p.Trp897Ter | |||||||||
HGVSg | CHROMOSOME_IV:g.13263617C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | |||||
Flanking_sequences | agctgagcaaattcgacgatggcgatctat | gattgtactgaatagtggagaaatggcatt | |||||||
Mapping_target | JC8 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004127 | ||||||||
WBStrain00005395 | |||||||||
WBStrain00006188 | |||||||||
WBStrain00008016 | |||||||||
WBStrain00026968 | |||||||||
WBStrain00027061 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006763 | |||||||
Transcript | JC8.10b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | JC8.10b.1:c.2708G>A | ||||||||
HGVSp | CE29050:p.Trp903Ter | ||||||||
cDNA_position | 2713 | ||||||||
CDS_position | 2708 | ||||||||
Protein_position | 903 | ||||||||
Exon_number | 10/12 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
JC8.10a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | JC8.10a.1:c.2690G>A | ||||||||
HGVSp | CE28239:p.Trp897Ter | ||||||||
cDNA_position | 2693 | ||||||||
CDS_position | 2690 | ||||||||
Protein_position | 897 | ||||||||
Exon_number | 9/11 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000517566 | ||||||||
WBInteraction000517568 | |||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000002 | Paper_evidence | WBPaper00001709 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | severe kinker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000017 | Paper_evidence | WBPaper00004275 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ric | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Strong allele. unc-26 mutants are strongly resistant to inhibitors of acetylcholinesterase, indicative of a decrease in acetylcholine release. | Paper_evidence | WBPaper00004275 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00001709 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | slow pharyngeal pumping | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000020 | Paper_evidence | WBPaper00001709 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00048926 | |||||||
Curator_confirmed | WBPerson11689 | ||||||||
Remark | resistant to lifespan extension by serotonin antagonists (mianserin, etc) | Paper_evidence | WBPaper00048926 | ||||||
Curator_confirmed | WBPerson11689 | ||||||||
Affected_by | Molecule | WBMol:00003509 | Paper_evidence | WBPaper00048926 | |||||
Curator_confirmed | WBPerson11689 | ||||||||
WBPhenotype:0000142 | Paper_evidence | WBPaper00048926 | |||||||
Curator_confirmed | WBPerson11689 | ||||||||
Remark | resistant to induction of stress resistance by serotonin antagonists (mianserin, etc) | Paper_evidence | WBPaper00048926 | ||||||
Curator_confirmed | WBPerson11689 | ||||||||
Affected_by | Molecule | WBMol:00003509 | Paper_evidence | WBPaper00048926 | |||||
Curator_confirmed | WBPerson11689 | ||||||||
WBPhenotype:0000210 | Paper_evidence | WBPaper00004275 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Strong allele. unc-26 mutants have reduced numbers of enteric muscle contractions, indicative of GABAergic function. | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00004275 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals are small. | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000314 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000349 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000455 | Paper_evidence | WBPaper00004275 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals move backwards with a jerky motion. | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000565 | Paper_evidence | WBPaper00004275 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; frequently coil. | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
WBPaper00001303 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Animals exhibited limited movement in the first two larval stages but it progressively improved with age. As adults, animals were capable of moving in sinusoidal patterns over shot distances. | Paper_evidence | WBPaper00001303 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
weak Unc | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001303 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00001709 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000996 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | strong Exp | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001213 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | little movement | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002056 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002382 | Paper_evidence | WBPaper00048427 | |||||||
Curator_confirmed | WBPerson11689 | ||||||||
Phenotype_assay | Genotype | dvIs19 [Pgst-4::GFP::NLS] | Paper_evidence | WBPaper00048427 | |||||
Curator_confirmed | WBPerson11689 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | ||||||
WBPaper00040857 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Mutation did not cause SNB-1::VENUS localization defects. | Paper_evidence | WBPaper00040857 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040857 | ||||||||
WBPaper00001709 | |||||||||
WBPaper00028886 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00004883 | |||||||||
WBPaper00004275 | |||||||||
WBPaper00016536 | |||||||||
WBPaper00017000 | |||||||||
WBPaper00013791 | |||||||||
WBPaper00001303 | |||||||||
WBPaper00048427 | |||||||||
WBPaper00048926 | |||||||||
Method | Substitution_allele |