WormBase Tree Display for Variation: WBVar00089700
expand all nodes | collapse all nodes | view schema
WBVar00089700 | Evidence | Paper_evidence | WBPaper00002413 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n717 | |||||||
Other_name | C48D1.2b.1:c.562-1G>A | ||||||||
C48D1.2a.1:c.1210-1G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.13200009C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C48D1 | |||||
Flanking_sequences | tttttaaatgataattaataaatttttgca | caagtgtggagaaagaagccgagccaagct | |||||||
Mapping_target | C48D1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002413 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005600 | ||||||||
WBStrain00005836 | |||||||||
WBStrain00026860 | |||||||||
WBStrain00026968 | |||||||||
WBStrain00027213 | |||||||||
WBStrain00027223 | |||||||||
WBStrain00027232 | |||||||||
WBStrain00027287 | |||||||||
WBStrain00040671 | |||||||||
WBStrain00040674 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000417 | |||||||
Transcript | C48D1.2a.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C48D1.2a.1:c.1210-1G>A | ||||||||
Intron_number | 7/9 | ||||||||
C48D1.2b.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C48D1.2b.1:c.562-1G>A | ||||||||
Intron_number | 3/4 | ||||||||
Interactor (29) | |||||||||
Genetics | Interpolated_map_position | IV | 8.46245 | ||||||
Mapping_data | In_multi_point | 689 | |||||||
690 | |||||||||
896 | |||||||||
In_pos_neg_data | 831 | ||||||||
Description | Phenotype | WBPhenotype:0000184 | Paper_evidence | WBPaper00044144 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | ced-3(n717) completely suppressed the accumulation of germ cell corpses seen in dlc-1(RNAi) worms | Paper_evidence | WBPaper00044144 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | CED-1::GFP; dlc-1(RNAi) | Paper_evidence | WBPaper00044144 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000216 | Paper_evidence | WBPaper00038432 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals displayed a weak extra A/PVM phenotype. | Paper_evidence | WBPaper00038432 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ayIs9[Pegl-17::gfp] | Paper_evidence | WBPaper00038432 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000386 | Paper_evidence | WBPaper00033433 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Copper-induced germ cell apoptosis was abolished in ced-3(n717) mutants (Figure 2A). | Paper_evidence | WBPaper00033433 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00033433 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Worms were exposed to 10 micromolar of copper for 12 hours | Paper_evidence | WBPaper00033433 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00030973 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The sisters of ASEL and ASER (which normally undergo apoptosis) survive and adopt the same fate as ASEL and ASER respectively | Paper_evidence | WBPaper00030973 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | 95 percent | Paper_evidence | WBPaper00030973 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005952 | PATO:0000460 | Paper_evidence | WBPaper00030973 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0006657 | PATO:0000460 | Paper_evidence | WBPaper00030973 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | All animals scored at 25C. | Paper_evidence | WBPaper00030973 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 25C | Paper_evidence | WBPaper00030973 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | otIs114 [lim-6p::GFP], ntIs1 [gcy-5p::GFP] | Paper_evidence | WBPaper00030973 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000590 | Paper_evidence | WBPaper00028561 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Germline cell corpse number is decreased compared to wild type. | Paper_evidence | WBPaper00028561 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00028561 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Germline corpses were quantified in staged adults (generally 24 hours after L4/adult molt) stained with SYTO12. | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | ced-10(RNAi) | Paper_evidence | WBPaper00028561 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000965 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 12.11.1 (n=15) extra cells were counted in the anterior pharynx. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | L3-L4 larvae were assayed. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00035076 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Salmonella infection decreased the lifespan of wild-type worms more than that of ced-3(n717)-mutant animals, indicating that the ced-3 mutation protects against Salmonella infection | Paper_evidence | WBPaper00035076 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035076 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001172 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Programmed cell deaths fail to occur. Very hard to score (ES1); difficult to score (ES2) in egl-1 background. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001268 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The number of germ cell corpses per gonad arm was not changed above control levels after administration of 1uM ceramide. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004926 | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00032243 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 1uM C16-ceramide was microinjected into the gonad. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001270 | Paper_evidence | WBPaper00004574 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No germ-line cell deaths were observed in a ced-3 mutant feeding on E. coli or S. typhimurium. | Paper_evidence | WBPaper00004574 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00004574 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001271 | Paper_evidence | WBPaper00004574 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ced-3 mutants are hypersusceptible to S. typhimurium-mediated killing. ced-3 mutants died much more quickly than wild-type worms when feeding on S. typhimurium, but died at the same rate as wild-type worms when feeding on E. coli. | Paper_evidence | WBPaper00004574 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001620 | Paper_evidence | WBPaper00053621 | |||||||
Curator_confirmed | WBPerson28450 | ||||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00053621 | |||||||
Curator_confirmed | WBPerson28450 | ||||||||
WBPhenotype:0001964 | Paper_evidence | WBPaper00051461 | |||||||
Curator_confirmed | WBPerson28450 | ||||||||
WBPhenotype:0002541 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Radiation-induced germ cell apoptosis was abolished. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00032243 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | At least 20 animals were scored for germ cell apoptosis at 36 hours post-120 Gy and compared to WT-irradiated controls. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00038332 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals produced viable progeny. | Paper_evidence | WBPaper00038332 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000072 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No gross phenotype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000590 | Paper_evidence | WBPaper00038332 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000966 | Paper_evidence | WBPaper00028759 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | germline is immortal at 20 and 25 degrees Celsius | Paper_evidence | WBPaper00028759 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Strains propagated for many generations and checked for sterility | Paper_evidence | WBPaper00028759 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001381 | Paper_evidence | WBPaper00046527 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | ced-3(n717) mutant worms were not resistant to anoxia exposure when fed a glucose-supplemented diet (Figure S1C) | Paper_evidence | WBPaper00046527 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003916 | Paper_evidence | WBPaper00046527 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001650 | Paper_evidence | WBPaper00031571 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Germ cells are condensed and unhealthy although not as severely altered as those of at wild type or ced-9 animals. | Paper_evidence | WBPaper00031571 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown on plates containing 400nM 5-FU for 12 hours from late L4 stage. | Paper_evidence | WBPaper00031571 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001651 | Paper_evidence | WBPaper00031571 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not progress to L4 (data not shown). | Paper_evidence | WBPaper00031571 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Embryos were transferred to plates containing 5-FU and remaining larva were counted after 72 hours. | Paper_evidence | WBPaper00031571 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001851 | Paper_evidence | WBPaper00027700 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants did not display significant radiosensitivity when compared with WT N2 C. elegans | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00027700 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 100-400 Gy radiation | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002486 | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutations in genes within the ced-1/6/7 pathway (ced-1, ced-7, nrf-5, ttr-52), the ced-2/5/12 pathway (ced-2, ced-5), or both pathways (ced-1;ced-2 and ced-7;ced-5) did not cause PGC lobes to persist in L1 larvae (Supplementary Table 1), indicating that ced-10 functions in PGC lobe scission in a different context than it does in cell corpse engulfment." (PGC = 'primordial germ cell') | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | All strains include the xnIs360 or xnSi1 transgenes to visualize PGC membranes. | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00016474 | ||||||||
WBPaper00016510 | |||||||||
WBPaper00038332 | |||||||||
WBPaper00038432 | |||||||||
WBPaper00027269 | |||||||||
WBPaper00016118 | |||||||||
WBPaper00011119 | |||||||||
WBPaper00016322 | |||||||||
WBPaper00011213 | |||||||||
WBPaper00030973 | |||||||||
WBPaper00014787 | |||||||||
WBPaper00028561 | |||||||||
WBPaper00014971 | |||||||||
WBPaper00027700 | |||||||||
WBPaper00022236 | |||||||||
WBPaper00004574 | |||||||||
WBPaper00023668 | |||||||||
WBPaper00017942 | |||||||||
WBPaper00010182 | |||||||||
WBPaper00028759 | |||||||||
WBPaper00023380 | |||||||||
WBPaper00019525 | |||||||||
WBPaper00031571 | |||||||||
WBPaper00032243 | |||||||||
WBPaper00033433 | |||||||||
WBPaper00035076 | |||||||||
WBPaper00010325 | |||||||||
WBPaper00044144 | |||||||||
WBPaper00046527 | |||||||||
WBPaper00050421 | |||||||||
WBPaper00051461 | |||||||||
WBPaper00053621 | |||||||||
WBPaper00065007 | |||||||||
Method | Substitution_allele |