WormBase Tree Display for Variation: WBVar00143286
expand all nodes | collapse all nodes | view schema
WBVar00143286 | Evidence | Person_evidence | WBPerson298 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e540 | |||||||
Other_name | K11C4.5o.1:c.9049-1G>A | ||||||||
K11C4.5d.1:c.8707-1G>A | |||||||||
K11C4.5e.1:c.9055-1G>A | |||||||||
K11C4.5l.1:c.8701-1G>A | |||||||||
K11C4.5m.1:c.9049-1G>A | |||||||||
K11C4.5c.1:c.9055-1G>A | |||||||||
K11C4.5b.1:c.8707-1G>A | |||||||||
K11C4.5f.1:c.8707-1G>A | |||||||||
K11C4.5n.1:c.8701-1G>A | |||||||||
K11C4.5k.1:c.9049-1G>A | |||||||||
K11C4.5g.1:c.9055-1G>A | |||||||||
K11C4.5i.1:c.9049-1G>A | |||||||||
K11C4.5p.1:c.8701-1G>A | |||||||||
K11C4.5a.1:c.9055-1G>A | |||||||||
K11C4.5j.1:c.8701-1G>A | |||||||||
K11C4.5h.1:c.8707-1G>A | |||||||||
HGVSg | CHROMOSOME_V:g.6912855C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | K11C4 | |||||
Flanking_sequences | tgagcatctctccttgtagaatgatttttc | tgaaaaaaaaaagaaaattgttgttaacat | |||||||
Mapping_target | K11C4 | ||||||||
Type_of_mutation | Substitution | C | T | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006801 | |||||||
Transcript (16) | |||||||||
Interactor | WBInteraction000501717 | ||||||||
WBInteraction000502865 | |||||||||
WBInteraction000504811 | |||||||||
WBInteraction000520126 | |||||||||
WBInteraction000524783 | |||||||||
WBInteraction000556209 | |||||||||
WBInteraction000556212 | |||||||||
Genetics | Interpolated_map_position | V | 0.473391 | ||||||
Mapping_data | In_2_point | 310 | |||||||
3136 | |||||||||
In_multi_point (11) | |||||||||
In_pos_neg_data | 847 | ||||||||
1743 | |||||||||
1749 | |||||||||
1775 | |||||||||
3073 | |||||||||
3082 | |||||||||
3432 | |||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weak kinker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000561 | Paper_evidence | WBPaper00000484 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | head region but not body resistant to 1 mM levamisole | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00000484 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0005739 | PATO:0000460 | Paper_evidence | WBPaper00000484 | ||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Phenotype_assay | Treatment | 1mM levamisole | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000563 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slight shrinker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence (3) | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2021 | |||||||||
WBPerson712 | |||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001599 | Paper_evidence | WBPaper00000484 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Head is resistant to ouabain treatment | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
head region but not body resistant to ouabain | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001924 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005739 | PATO:0000460 | Paper_evidence | WBPaper00000484 | ||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Phenotype_assay | Treatment | 1mM ouabain | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (20) | |||||||||
Remark | We sequenced e540 for Mueller, et al (eLife, in revision). e540 is a splice acceptor mutation. alt_det = V: 6912855C>T mut_det = G>A in splice acceptor upstream of exon 23 in unc-68 | Person_evidence | WBPerson298 | ||||||
Curator_confirmed | WBPerson51134 | ||||||||
Variation information submitted by WBPerson298 on 2022-10-25_12:05:38 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||||
Method | Substitution_allele |