WormBase Tree Display for Variation: WBVar00088794
expand all nodes | collapse all nodes | view schema
WBVar00088794 | Evidence | Paper_evidence | WBPaper00005913 | ||
---|---|---|---|---|---|
Accession_evidence | AJ505905 | ||||
Name | Public_name | mc44 | |||
Other_name | CE54019:p.Leu3504GlnfsTer11 | ||||
ZK1151.1n.1:c.6407_7349del | |||||
CE51904:p.Leu3631GlnfsTer11 | |||||
ZK1151.1k.1:c.10172_11114del | |||||
ZK1151.1j.1:c.10511_11453del | |||||
ZK1151.1c.1:c.10511_11453del | |||||
CE51855:p.Leu3504GlnfsTer11 | |||||
CE19338:p.Leu2022GlnfsTer11 | |||||
ZK1151.1m.1:c.10553_11495del | |||||
CE51884:p.Leu3391GlnfsTer11 | |||||
ZK1151.1o.1:c.6065_7007del | |||||
ZK1151.1l.1:c.10892_11834del | |||||
CE51862:p.Leu2136GlnfsTer11 | |||||
CE51845:p.Leu3518GlnfsTer11 | |||||
HGVSg | CHROMOSOME_I:g.11751862_11752863del | ||||
Sequence_details | SMap | S_parent | Sequence | ZK1151 | |
Flanking_sequences | ctccgcttttggaatcagttgctggagaac | agatgctccaccgcacctggcggctaccgt | |||
Mapping_target | ZK1151 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00026573 | ||||
Laboratory | ML | ||||
Status | Live | ||||
Affects | Gene | WBGene00006876 | |||
Transcript | ZK1151.1n.1 (11) | ||||
ZK1151.1k.1 (11) | |||||
ZK1151.1j.1 (11) | |||||
ZK1151.1m.1 (11) | |||||
ZK1151.1c.1 (11) | |||||
ZK1151.1o.1 (11) | |||||
ZK1151.1l.1 (11) | |||||
Genetics | Interpolated_map_position | I | 9.6126 | ||
Description | Phenotype (2) | ||||
Reference | WBPaper00040080 | ||||
WBPaper00005913 | |||||
WBPaper00061173 | |||||
Remark | mc44 is a 1033 bp deletion | Paper_evidence | WBPaper00005913 | ||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Method | Deletion_allele |